Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping

The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping Amylase 2022; 6: 11–19 Research Article Manon Molina, Thomas Prévitali, Claire Moulis, Gianluca Cioci, Magali Remaud-Siméon* The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping https://doi.org/10.1515/amylase-2022-0002 Keywords: glucansucrase; branching sucrase; chimera; Received November 8, 2021; accepted January 25, 2022. GH70 enzymes; domain C; enzyme stability. Abstract: Sucrose-active enzymes belonging to the glycoside hydrolase (GH) family 70 are attractive tools Abbreviations for the synthesis of oligosaccharides, polysaccharides or glycoconjugates. However, their thermostability is an ASR, alternansucrase; CD, catalytic domain; DSF, important issue for the development of robust and cost- differential scanning fluorimetry; GBD, glucan binding effective enzyme-based processes. Indeed, GH70 enzymes domain; GH, glycoside hydrolase; T , melting temperature. are mesophilic and no thermophilic representatives have been described so far. Furthermore, structurally guided engineering is a challenge given the size of these 1 Introduction proteins (120 to 250 kDa) and their organization in five domains. Herein, we have investigated the possible role The alternansucrase (ASR) and the α-1,2 branching sucrase of the domain C in the stability of GH70 enzymes. The GBD-CD2 (GBD and CD stand for glucan binding domain alternansucrase (ASR) is the most stable enzyme of the and catalytic domain, respectively) are promising enzymes GH70 family. Structural comparison of ASR to other GH70 for the development of industrial applications including enzymes highlighted the compactness of its domain C. We polysaccharide, oligosaccharide or glycoconjugate assumed that this atypical structure might be involved synthesis via the glucosylation of many different acceptors in the stability of this enzyme and decided to introduce from sucrose substrate, an abundant and low-cost this domain in another much less stable GH70 enzyme resource [1-5]. These efficient α-transglucosylases belong of known three-dimensional structure, the branching to the family 70 of the glycoside hydrolases (GH) according sucrase GBD-CD2. The chimeric GBD-CD2 exhibited a lower to the CAZy classification [6]. They are both mesophilic specific activity on sucrose substrate but its specificity enzymes produced by lactic acid bacteria. was unchanged with the enzyme remaining specific for The ASR from Leuconostoc citreum NRRL B-1355 is the branching of dextran via α-1,2 linkage formation. one of the most stable enzymes of the GH70 family, with Interestingly, the chimera showed a higher melting an optimum temperature of 45 °C [7], and a half-time life temperature and residual activity than the wild-type of 75 hours at 30 °C and 6 hours at 40 °C determined for enzyme after 10 min incubation at 30 °C showing that the the recombinant enzyme [8]. This old-known enzyme domain C can affect GH70 enzyme stability and could be a has attracted interest because of the peculiarity of the potential target of both random or rational mutagenesis to high molar mass polymer it produces from sucrose and further improve their stability. which was named alternan because of the presence of alternative α-1,6 and α-1,3 linkages in the polymer main chain [9]. Thanks to its physico-chemical properties, the alternan polymer is a good candidate for replacing gum Arabic [10,11] and the oligoalternans have interesting prebiotic properties [12-14]. The three-dimensional *Corresponding author: Magali Remaud-Siméon, Toulouse Biotechnology Institute (TBI), Université de Toulouse, CNRS, INRAE, structure of a truncated variant of this glucansucrase INSA, 135, Avenue de Rangueil, CEDEX 04, F-31077 Toulouse, France, (ASRΔ2, comprising amino acids Ala29 to Gly1425; PDB ID: E-mail: remaud@insa-toulouse.fr 6HVG) revealed that ASR adopts a U-shaped fold formed Manon Molina, Thomas Prévitali, Claire Moulis, Gianluca Cioci, by five distinct domains A, B, C, IV and V like other GH70 Toulouse Biotechnology Institute (TBI), Université de Toulouse, enzymes [15-20]. Domains A, B, IV and V are made up by CNRS, INRAE, INSA, 135, Avenue de Rangueil, CEDEX 04, F-31077 Toulouse, France sequence fragments on either side of domain C [18]. Five Open Access. © 2022 Manon Molina et al., published by De Gruyter. This work is licensed under the Creative Commons Attribution 4.0 International License. 12  Manon Molina et al. other tertiary structures of ASRΔ2 were solved in complex 2 Results and discussion with different oligosaccharides (PDB IDs: 6SYQ, 6T1P, 6T16, 6SZI, 6T18). They enabled the identification of two 2.1 Structural comparison of domain C of sugar binding pockets (V-A and V-B) and revealed the GH70 enzymes presence of a unique oligosaccharide binding site at the surface of domain A [21]. The domain C was extracted from the whole tertiary The branching sucrase GBD-CD2 from Leuconostoc structure (Fig. 1A) for analysis. The structural comparison citreum NRRL B-1299 is an α-1,2 branching sucrase of the domain C of ASR with those of other GH70 sucrose that performs α-1,2 glucosylation of exogenous active enzymes (i.e. GTF180, GTF-SI, GTFA, GBD-CD2 and isomaltooligosaccharides or α-1,6 linked dextran using DSR-M) highlighted significant differences (Fig. 1B). First, sucrose as glucosyl donor. Up to 40% of α-1,2 osidic 882 890 ASR presents three peptide insertions: SSGKDLKDGE , linkages, a rare linkage in nature, can be introduced [4]. 913 916 996 1000 QDNS and KQDGT , insertion 1, 2 and 3, The resulting α-1,2 glucooligosaccharides are resistant to respectively in Figure 1. Notably, insertion 3 is part of a the hydrolysis by digestive enzymes from both humans β-hairpin (from Thr991 to Glu1005) and is only found in and animals and show prebiotic activity [22-24]. GBD-CD2 the ASR structure. is also an attractive tool for the glucosylation of other In addition, four ionic interactions can be predicted oligosaccharides or hydroxylated molecules. For instance, in the domain C of ASR against two for DSR-M, GTF-SI the wild-type enzyme and several mutants catalysed and GTF180 and none for GTFA and GBD-CD2. Similarly, the glucosylation of tetrasaccharides entering in the ASR domain C harbours seven π-π stacking interactions, composition of different oligosaccharidic motifs found in whereas only two or three are predicted for the others. Shigella flexneri O-antigens (notably in the serotypes 3a, 2b, Sequence alignment of the domain C of ASR and GBD-CD2 3a, 4a or 4b) and stand as interesting tools for the chemo- shows that the two domains share 49.64% of identity, while enzymatic synthesis of carbohydrate-based vaccines their extremities are highly conserved (Fig. 2). In addition, [25,26]. This enzyme was also successfully engineered the number of residues Ile, Val, Leu and Phe showing the for flavonoid glucosylation and several variants were highest hydrophobicity according to Kyte and Doolittle obtained, which increased naringenin conversion from scale [29] is higher in ASR than in GBD-CD2 domain C. Many 14% to 60% and morin from 20% to 67% compared to of them participate in a hydrophobic interface with domain the wild-type [27]. The three-dimensional structure of a A or into local hydrophobic cores of domain C (Figs 2 and 3). truncated version of GBD-CD2 (∆N -GBD-CD2) was solved All together, these specific structural features (i.e. in 2012 (PDB ID: 3TTQ). Two sugar binding pockets (V-L hydrophobic cores, hydrophobic interface, ionic or π-π and V-K) were structurally characterized in the domain V of stacking interactions) are likely to be important for the enzyme, confirming the designation “glucan binding protein folding and thermal stability, and let us assume domain” [28]. However, a limit to GBD-CD2 utilization is that the ASR domain C could be involved in the higher its relative poor stability, with a half-life time of 10 hours stability of this enzyme. So, we hypothesized that it could at 30 °C and only 15 minutes at 40 °C [4]. enhance the stability of GBD-CD2, known to be less stable Structural comparisons of ASR and GBD-CD2 further than ASR. To assess our hypothesis, we replaced the revealed that although the C-domain of ASR contains domain C of ΔN -GBD-CD2 by that of ASR. Importantly, longer loops, it also harbours a higher number of β-strands the design and the construction of this chimeric enzyme and a higher level of interactions than those found in GBD- were facilitated by the high level of conservation of the CD2. The C-domain is the only domain in GH70 enzymes amino acid sequences found at the N- and C-terminal consisting of a contiguous segment, forming a Greek key extremities of both domains C, limiting the risk of a motif at the bottom of the ‘U’ fold and acting as a pedestal. complete destabilization of the overall fold due to domain We therefore hypothesized that the greater compactness C swapping (Fig. 2; orange dotted boxes). of the ASR C-domain might enhance the thermostability of this enzyme. By analogy, the introduction of the ASR C-domain into the structure of GBD-CD2 could thus 2.2 Production of the chimeric enzyme increase the stability of the latter. It is this hypothesis that we wanted to study here by creating a chimeric protein Using the protocol of production previously optimized comprising domains A, B, IV, V of GBD-CD2 grafted onto for the wild-type enzyme ΔN -GBD-CD2 [31], the part of the C domain of ASR and by characterizing the biochemical enzyme recovered in the insoluble fraction as aggregates or properties of the chimera obtained. inclusion bodies was greater for the chimera (Fig. 4A). We The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  13 Figure 1: (A) View of the overall structure of ASR with the five domains: V (red), IV (yellow), B (green), A (blue) and C (purple). (B) Comparison of the domain C of available glucansucrase and branching sucrase structures. Figure 2: Sequence alignment of the domain C of ASR and GBD-CD2 (ASR: 873-1030, GBD-CD2: 2424-2562). Arrows indicate the residues that differ in GBD-CD2 and that are thought to be involved in ASR domain C stability or folding. Blue triangle: hydrophobic interface with domain A; orange star: ionic interaction; pink circle: local hydrophobic core; green diamond: π-π stacking interaction. Orange dotted boxes: high similarity between the N-terminal and C-terminal parts of domains C. Alignment created with ENDscript 2 [30]. therefore tested the production of the wild-type enzymes 2.3 Effect of domain C swapping on GBD-CD2 and the chimera in the presence of a chaperone protein specificity and thermal stability to facilitate protein folding. We used Escherichia coli BL21 star cells previously transformed with the commercial The specific activity of the ΔN -GBD-CD2-chimera was -1 -1 pTf16 plasmid harbouring the Tig chaperone. As shown in estimated at 11.6 U.mg , versus 16.9 U.mg for the wild-type Figure 4, the production of enzymes in the soluble fraction enzyme when tested on sucrose substrate only. With 69% increased and reached sufficient production levels to of residual activity compared to the wild-type enzyme, perform biochemical characterization (Fig. 4A). The ΔN - the ΔN -GBD-CD2-chimera was impacted by the domain 123 123 GBD-CD2-chimera was then purified and characterized to swapping but not to a major extent. compare its stability, efficiency and specificity with those Furthermore, H NMR spectra of the reaction products of the wild-type enzyme. To note, the Tig chaperone did obtained from sucrose and 70 kDa dextran with ΔN - not appear on the SDS-PAGE after purification (Fig. 4B). GBD-CD2 and ΔN -GBD-CD2-chimera are perfectly 14  Manon Molina et al. Figure 3: Residues involved in domain C packing. (A) View of ASR domain C hydrophobic residues (Ile, Val, Leu, Phe, Cys, Met, Ala) involved in the interface between domain A and C (Met878, Leu895, Ile924, Val926, Val928, Leu958, Val959, Ile966, Val968, Leu1013, Ile1014, Leu1018, Val1020 and Val1022). (B) View of the residues involved into ionic interactions in ASR domain C (Asp881-Lys940, Lys935-Glu1005, Asp963-Lys1007 and Asp970-Lys974). (C) View of the residues involved into local hydrophobic cores in ASR domain C (Leu894, Phe900, Ile904, Ile927, Leu934, Leu936, Ile942, Leu944, Met946, Ala949, Ala957, Leu960, Leu978, Leu986, Phe988, Phe994 and Met1006). (D) View of the residues involved into π-π stacking interactions in ASR domain C (Tyr919-His950, His950-Tyr955, Phe988-Phe994, Phe988- Trp1021, Phe994-Tyr1004, Phe994-Trp1021 and Tyr1004-Tyr1017). (E) View of the residues involved into local hydrophobic cores in GBD-CD2 domain C (Leu2472, Leu2474, Leu2436, Leu2498, Ile2465, Ala2495, Leu2482, Leu2523, Met2484, Ala2515, Val2480, Ile2530). (F) View of the residues involved into π-π stacking interactions in GBD-CD2 domain C (Tyr2549-Trp2553, His2488-Tyr2493). The oxygen, nitrogen and sulphur atoms are coloured in red, blue and yellow, respectively. The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  15 Figure 4: (A) SDS-PAGE electrophoresis with and without tig chaperone for ΔN -GBD-CD2 and ΔN -GBD-CD2-chimera. 1: Soluble fraction 123 123 ΔN -GBD-CD2; 2: soluble fraction ΔN -GBD-CD2-chimera; 3: soluble fraction ΔN -GBD-CD2 with tig chaperone; 4: soluble fraction 123 123 123 ΔN -GBD-CD2-chimera with tig chaperone; 5: insoluble fraction ΔN -GBD-CD2; 6: insoluble fraction ΔN -GBD-CD2-chimera; 7: insoluble 123 123 123 fraction ΔN -GBD-CD2 with Tig chaperone; 8: insoluble fraction ΔN -GBD-CD2-chimera with tig chaperone. (B) SDS-PAGE electrophoresis 123 123 of the purified ΔN -GBD-CD2. 1: purified fraction A3; 2: purified fraction A6. stackable (Fig. 5). The signals at 5.11 and 5.19 ppm are Another way to compare enzyme stability is the characteristic of the formation α-1,2 branching linkages in determination of the residual activity after a period of the linear dextran and their integration accounts for 36% incubation at a given temperature. After 10 minutes α-1,2 linkage in both cases. These results indicate that incubation at 30 °C, the percentage of residual activity was domain C swapping did not affect the enzyme specificity, of 53% and 36% for the chimera and the wild-type ΔN - namely its ability to branch dextran molecules with GBD-CD2, respectively. This difference is in agreement glucosyl units linked through α-1,2 linkage. with the DSF results and shows that the chimeric enzyme The melting temperatures of ΔN -GBD-CD2 and is slightly more resistant to temperature than its wild-type ΔN -GBD-CD2-chimera were determined by differential homologue suggesting that the domain C swapping has scanning fluorimetry (DSF) (Fig. 6). Both DSF curves slightly improved the stability of ΔN -GBD-CD2. revealed the presence of two peaks (A and B) corresponding to two melting temperatures (T ). The presence of different melting temperatures is often observed for multi-modular 3 Conclusion enzymes, such as the GH70 family enzymes. The first T (peak A) and the second one (peak B) correspond to T Studies focusing on stability improvement of GH70 values of 37.7 °C and 44.5 °C for the chimera versus 37.1 family enzymes using protein engineering are scarce. °C and 41.6 °C for the wild-type enzyme. The variation of One study reports the mutation of proline residues 0.6 °C and 2.9 °C for the two melting temperatures seems to serine or lysine to threonine in order to introduce to indicate that the chimeric enzyme is more stable than stabilizing hydrogen bonds in the dextransucrase from the wild-type ΔN -GBD-CD2, even if the increase of T Leuconostoc mesenteroides 0326 [32]. One mutant showed 123 m especially for the second peak must be taken with caution a 2-fold increase in catalytic efficiency, the same optimum due the bad peak resolution. temperature of 25 °C and a half-life time at 35 °C that increased from 6.6 minutes for the wild-type to 48.8 16  Manon Molina et al. Figure 5: H NMR spectra of ∆N -GBD-CD2 and its chimera. Reaction from 292 mM sucrose, 309 mM of 70 kDa dextran in 50 mM NaAc buffer pH 5.75 at 30 °C over a period of 24 hours. Figure 6: (A) Evolution of the relative fluorescence and (B) derivative of the relative fluorescence units (RFU) during the denaturation of ΔN - GBD-CD2 and ΔN -GBD-CD2-chimera. minutes for the mutant [32]. A second approach relied stability. The domain V was artificially extended using on disulphide bridge introduction in the dextransucrase ferredoxin as a suffix, and several truncations of this and resulted in the identification of mutants revealing a suffix were tested. The best improvement obtained was shift of the optimum temperature from 25 °C to 35 °C but an increase of half-life time of 280% and 200% at 35 °C no improvement of thermostability [33]. Very recently, and 45 °C, respectively. These recent results highlight engineering was performed on the C-terminal part of the potential of engineering domain V for stability [34], a dextransucrase dexYG domain V to improve the enzyme strategy that could be coupled to domain C engineering. The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  17 -1 -1 In this study, we performed an exchange of domain 100 µg.mL and chloramphenicol 20 µg.mL was used to C between two GH70 enzymes showing different thermal inoculate a culture at an OD of 0.05 in ZYM-5052 auto- 600nm stability. Indeed, we noticed that the domain C, found at inducible medium [35] modified by supplementation with -1 -1 the basis of U-shape structure, is more compact in the ASR 100 µg.mL ampicillin and 20 µg.mL chloramphenicol, -1 than in the GBD-CD2, our two model enzymes, and it was 4 mg.mL arabinose, 0.75%(w/v) α-lactose, 1.5%(w/v) suspected to be involved in the highest stability of the ASR glycerol and 0.05% glucose for ΔN -GBD-CD2 and ΔN - 123 123 compared to that of the GBD-CD2. To test this hypothesis, GBD-CD2 chimera production (conditions optimized we have successfully constructed and produced a chimeric previously [31]). After 24 hours at 23 °C, cells were enzyme, in which the domain C of GBD-CD2 was exchanged harvested by centrifugation and re-suspended in binding by that of ASR. Our results indicate that the branching buffer containing 20 mM phosphate buffer, 20 mM sucrase ΔN -GBD-CD2 has slightly increased in thermal imidazole (Merck Millipore), 500 mM NaCl and 50 mM stability after acquiring the domain C of ASR, without sodium acetate buffer pH 5.75. Final OD was 30. Cells 600nm modification of its specificity. Rigidification of domain were disrupted by sonication and debris was removed C could thus be an approach that might deserve further by a centrifugation step at 45,000 × g for 30 minutes at investigations to increase the GH70 enzyme stability. 8 °C. Purification was performed with ÄKTA Xpress system (GE Healthcare). Twenty mM imidazole and 500 mM NaCl were added to the soluble fraction prior to the purification of ΔN -GBD-CD2 and ΔN -GBD-CD2 123 123 4 Experimental procedures chimera. Two-step purification was performed in a cold chamber at 12 °C using: (i) a HisTrap HP 1 mL column (GE 4.1 Chimera design and construction Healthcare) for the affinity step; and (ii) a Superose12 16/60 (GE Healthcare) for the size exclusion step; and Clustal Omega (https://www.ebi.ac.uk/Tools/msa/ protein was eluted in MES buffer pH 6.5 at 30 mM with -1 clustalo/) was used to align ASR and GBD-CD2 sequence 100 mM NaCl and 0.05 g.L CaCl . Purified fractions were and Genome Compiler (http://www.genomecompiler.com/) pooled together and concentrated using AmiconUltra-15 -1 was used to construct and manipulate plasmid cards. with a cut-off of 50 kDa to 10-15 mg.mL . Purification was Domain C of ASR was amplified by PCR using pET53- checked by SDS-PAGE electrophoresis using NuPAGE asr-Δ2 as template, Phusion® polymerase (NEB), forward 3-8% Tris-Acetate protein gels (Invitrogen), and protein primer ACGGCTCGTAAAAGCTATGTCTCTGGTGGGCAAA- concentration was assessed by spectroscopy at 280 nm CAATG and reverse primer TGTACGGGCATCTTGATTGT- using a NanoDrop instrument. The theoretical molecular CACTAGCTCCAACTGGCACC. The underlined sequence weight and molar extinction coefficient of the enzymes corresponds to the overlap with ΔN -gbd-cd2 gene. were calculated using the ExPASy ProtParam tool (https:// Plasmid of pET53-ΔN -gbd-cd2 was amplified without the web.expasy.org/protparam/). The molecular weight is of domain C with the primers GACAATCAAGATGCCCGTACAG 127.56 kDa and 157.26 kDa for the GBD-CD2-chimera and and GACATAGCTTTTACGAGCCGTC. PCR products were ASR-chimera, respectively. Extinction coefficient is of -1 -1 purified with GenElute PCR Clean-up kit (Sigma) and DNA 196310 and 213730 M .cm for the GBD-CD2-chimera and was quantified using a NanoDrop instrument. Assemblage ASR-chimera, respectively. of ΔN -gbd-cd2 plasmid with asr-Δ2 domain C was made using NEBuilder HiFi DNA Assembly kit with a molar ratio vector:insert of 1:2. Ligation product was transformed in 4.3 Activity measurement home-made E. coli DH5α competent cells and sequences of the constructions were checked by sequencing (GATC). Activity was determined in triplicate at 30 °C in a Thermomixer (Eppendorf) using the 3,5-dinitrosalicylic acid method [36]. Fifty mM sodium acetate buffer pH 5.75, 4.2 Production and purification of chimera -1 292 mM sucrose and 0.002 mg.mL of pure ΔN -GBD-CD2 and wild-type enzymes enzyme were used. One unit of activity is defined as the amount of enzyme that hydrolyses 1 µmol of sucrose per The E. coli BL21 DE3* strain transformed with a plasmid minute. harbouring the Tf16 chaperone gene (Takara) was used for enzyme production. A pre-culture of transformed E. coli BL21 DE3* in LB medium supplemented with ampicillin 18  Manon Molina et al. 4.4 Enzymatic reactions and product Conflict of interest: The authors declare no conflict of interest. characterization ΔN -GBD-CD2 and ΔN -GBD-CD2 chimera branching 123 123 -1 reactions were performed using 1 U.mL of pure enzyme References with 292 mM sucrose and 309 mM of 70 kDa dextran in [1] Molina M., Cioci G., Moulis C., Séverac E., Remaud-Siméon 50 mM NaAc buffer pH 5.75 at 30 °C over a period of 24 M., Bacterial α-glucan and branching sucrases from GH70 hours. These polymers were purified by dialysis using 14 family: discovery, structure–function relationship studies kDa cut-off cellulose dialysis tubing (Sigma-Aldrich) in and engineering. Microorganisms 2021, 9, 1607. https://doi. water and analysed by NMR. NMR samples were prepared org/10.3390/microorganisms9081607 by dissolving 10 mg of purified product in 0.5 mL D O. [2] Bertrand A., Morel S., Lefoulon F., Rolland Y., Monsan P., Remaud-Simeon M., Leuconostoc mesenteroides glucansucrase Deuterium oxide was used as the solvent, and sodium synthesis of flavonoid glucosides by acceptor reactions 2,2,3,3-tetradeuterio-3-trimethylsilylpropanoate (TSPD ) in aqueous-organic solvents. Carbohydr. Res. 2006, 341, 1 13 was selected as the internal standard (δ H = 0 ppm, δ C 855–863. https://doi.org/10.1016/j.carres.2006.02.008 = 0 ppm). H spectra were recorded on a Bruker Avance [3] Grimaud F., Faucard P., Tarquis L., Pizzut-Serin S., Roblin P., 500-MHz spectrometer operating at 500.13 MHz. The Morel S., et al., Enzymatic synthesis of polysaccharide-based data were processed using TopSpin 3.0 software. One- copolymers. Green Chem. 2018, 20, 4012–4022. https://doi. org/10.1039/C8GC01251B dimensional H NMR spectra were acquired by using a [4] Brison Y., Fabre E., Moulis C., Portais J.C., Monsan P., Remaud- zgpr pulse sequence (with water suppression). Spectra Siméon M., Synthesis of dextrans with controlled amounts were performed at 298 K. of α-1,2 linkages using the transglucosidase GBD-CD2. Appl. Microbiol. Biotechnol. 2010, 86, 545–554. https://doi. org/10.1007/s00253-009-2241-z [5] Musa A., Miao M., Zhang T., Jiang B., Biotransformation of 4.5 Enzyme melting temperature stevioside by Leuconostoc citreum SK24.002 alternansucrase determination acceptor reaction. Food Chem. 2014, 146, 23–29. https://doi. org/10.1016/j.foodchem.2013.09.01 DSF experiments were performed in triplicates with 7 µM [6] Lombard V., Golaconda Ramulu H., Drula E., Coutinho P.M., of pure enzyme in 50 mM sodium acetate buffer pH 5.75 Henrissat B., The carbohydrate-active enzymes database -1 supplemented with 0.5 g.L of CaCl and 10 X of SYPRO (CAZy) in 2013. Nucleic Acids Res. 2014, 42, D490–D495. https://doi.org/10.1093/nar/gkt1178 orange (Life Technologies). A ramp from 20 °C to 80 °C [7] López-Munguía A., Pelenc V., Remaud M., Biton J., Michel J.M., was applied with 0.3 °C increments on a C1000 Thermal Lang C., et al., Production and purification of alternansucrase, Cycler apparatus from Bio-Rad. a glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355, for the synthesis of oligoalternans. Enzyme Microb. Technol. 1993, 15, 77–85. https://doi.org/10.1016/0141- 0229(93)90120-Q 4.6 Structural analysis of the enzymes [8] Joucla G., Caractérisation de l’alternane-saccharase de Leuconostoc mesenteroides NRRL B-1355: Approche rationnelle To analyse the network of interactions in the structure, et aléatoire pour la conception de nouvelles glucane- the RING [37] web server was used (Residue Interaction saccharases. Thèse de doctorat, Institut national des sciences Network Generator; http://protein.bio.unipd.it/ring). It appliquées de Toulouse, Toulouse, 2003. identifies and lists all the non-covalent interactions in the [9] Côté G.L., Robyt J.F., Isolation and partial characterization of an extracellular glucansucrase from Leuconostoc mesenteroides PDB loaded file (hydrogen bond, Van der Waals, ionic, π-π NRRL B-1355 that synthesizes an alternating (1→6),(1→3)-α-D- stacking, π-cation). glucan. Carbohydr. Res. 1982, 101, 57–74. https://doi. org/10.1016/S0008-6215(00)80795-8 Acknowledgments: We are grateful to the Engineering [10] Côté G.L., Low-viscosity α-d-glucan fractions derived from and Screening for Original Enzymes facility (ICEO) of sucrose which are resistant to enzymatic digestion. Carbohydr. Polym. 1992, 19, 249–252. https://doi.org/10.1016/0144- Toulouse Biotechnology Institute, which is part of the 8617(92)90077-4 Integrated Screening Platform of Toulouse, for access to [11] Leathers T.D., Nunnally M.S., Côté G.L., Modification of alternan HPLC and protein purification facilities. We also thank by dextranase. Biotechnol. Lett. 2009, 31, 289–293. https:// Dr. Sandrine Morel and the Metasys platform of TBI doi.org/10.1007/s10529-008-9866-3 (Toulouse,France) for the NMR experiments. [12] Côté G.L., Holt S.M., Miller-Fosmore C., Prebiotic oligosaccharides via alternansucrase acceptor reactions. ACS The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  19 Symposium Series 2003, 849, 76–89. https://doi.org/10.1021/ [25] Hu Z., Benkoulouche M., Barel L.A., Le Heiget G., Ben bk-2003-0849.ch007 Imeddourene A., Le Guen Y., et al., Convergent chemoenzymatic [13] Holt S.M., Miller-Fosmore C.M., Côté G.L., Growth of strategy to deliver a diversity of Shigella flexneri serotype- various intestinal bacteria on alternansucrase-derived specific O-antigen segments from a unique lightly protected oligosaccharides. Lett. Appl. Microbiol. 2005, 40, 385–390. tetrasaccharide core. J. Org. Chem. 2021, 86, 2058–2075. https://doi.org/10.1111/j.1472-765X.2005.01681.x https://doi.org/10.1021/acs.joc.0c00777 [14] Sanz M.L., Côté G.L., Gibson G.R., Rastall R.A., Prebiotic [26] Benkoulouche M., Ben Imeddourene A., Barel L.A., Le properties of alternansucrase maltose-acceptor Heiget G., Pizzut S., Kulyk H., et al., Redirecting substrate oligosaccharides. J. Agric. Food Chem. 2005, 53, 5911–5916. regioselectivity using engineered ΔN -GBD-CD2 branching https://doi.org/10.1021/jf050344e sucrases for the production of pentasaccharide repeating units [15] Brison Y., Pijning T., Malbert Y., Fabre É., Mourey L., Morel S., of S. flexneri 3a, 4a and 4b haptens. Sci. Rep. 2021, 11, 2474. et al., Functional and structural characterization of α-(1→2) https://doi.org/10.1038/s41598-021-81719-1 branching sucrase derived from DSR-E glucansucrase. J. Biol. [27] Malbert Y., Moulis C., Brison Y., Morel S., André I., Remaud- Chem. 2012, 287, 7915–7924. https://doi.org/10.1074/jbc. Simeon M., Engineering a branching sucrase for flavonoid M111.305078 glucoside diversification. Sci. Rep. 2018, 8, 15153. https://doi. [16] Claverie M., Cioci G., Vuillemin M., Monties N., Roblin org/10.1038/s41598-018-33394-y P., Lippens G., et al., Investigations on the determinants [28] Brison Y., Malbert Y., Czaplicki G., Mourey L., Remaud-Simeon responsible for low molar mass dextran formation by DSR-M M., Tranier S., Structural insights into the carbohydrate- dextransucrase. ACS Catal. 2017, 7, 7106–7119. https://doi. binding ability of an α-(1→2) branching sucrase from glycoside- org/10.1021/acscatal.7b02182 hydrolase family 70. J. Biol. Chem. 2016, 7527–7540. https:// [17] Ito K., Ito S., Shimamura T., Weyand S., Kawarasaki Y., Misaka doi.org/10.1074/jbc.M115.688796 T., et al., Crystal structure of glucansucrase from the dental [29] Kyte J., Doolittle R.F., A simple method for displaying the caries pathogen Streptococcus mutans. J. Mol. Biol. 2011, 408, hydropathic character of a protein. J. Mol. Biol. 1982, 157, 177–186. https://doi.org/10.1016/j.jmb.2011.02.028 105–132. https://doi.org/10.1016/0022-2836(82)90515-0 [18] Molina M., Moulis C., Monties N., Pizzut-Serin S., Guieysse [30] Robert X., Gouet P., Deciphering key features in protein D., Morel S., et al., Deciphering an undecided enzyme: structures with the new ENDscript server. Nucleic Acids Res. investigations of the structural determinants involved in the 2014, 42, W320–W324. https://doi.org/10.1093/nar/gku316 linkage specificity of alternansucrase. ACS Catal. 2019, 9, [31] Vuillemin M., Malbert Y., Laguerre S., Remaud-Siméon M., 2222–2237. https://doi.org/10.1021/acscatal.8b04510 Moulis C., Optimizing the production of an α-(1→2) branching [19] Pijning T., Vujičić-Žagar A., Kralj S., Dijkhuizen L., Dijkstra BW., sucrase in Escherichia coli using statistical design. Appl. Structure of the α-1,6/α-1,4-specific glucansucrase GTFA from Microbiol. Biotechnol. 2014, 98, 5173–5184. https://doi. Lactobacillus reuteri 121. Acta Crystallogr. Sect. F Struct. Biol. org/10.1007/s00253-014-5627-5 Cryst. Commun. 2012, 68, 1448–1454. https://doi.org/10.1107/ [32] Li M.Q., Zhang H.B., Li Y., Hu X.Q., Yang J.W., The thermoduric S1744309112044168 effects of site-directed mutagenesis of proline and lysine [20] Vujicic-Zagar A., Pijning T., Kralj S., López C.A., Eeuwema on dextransucrase from Leuconostoc mesenteroides 0326. W., Dijkhuizen L., et al., Crystal structure of a 117 kDa Int. J. Biol. Macromol. 2018, 107, 1641–1649. https://doi. glucansucrase fragment provides insight into evolution org/10.1016/j.ijbiomac.2017.10.023 and product specificity of GH70 enzymes. Proc. Natl. Acad. [33] Zhang Y., Yang J., Yu X., Hu X., Zhang H., Engineering Sci. USA 2010, 107, 21406–21411. https://doi.org/10.1073/ Leuconostoc mesenteroides dextransucrase by inserting pnas.1007531107 disulfide bridges for enhanced thermotolerance. Enzyme [21] Molina M., Moulis C., Monties N., Guieysse D., Morel S., Microb. Technol. 2020, 139, 109603. https://doi.org/10.1016/j. Cioci G., et al., A specific oligosaccharide-binding site in enzmictec.2020.109603 the alternansucrase catalytic domain mediates alternan [34] Zhang Y.X., Yang J.W., Wu Y.Y., Hu X.Q., Zhang H.B., The elongation. J. Biol. Chem. 2020, 295, 9474–9489. https://doi. stability improvement of dextransucrase by artificial extension org/10.1074/jbc.RA120.013028 modification of the V domain of the enzyme. Enzyme Microb. [22] Djouzi Z., Andrieux C., Pelenc V., Somarriba S., Popot F., Technol. 2021, 151, 109919. https://doi.org/10.1016/j. Paul F., et al., Degradation and fermentation of α-gluco- enzmictec.2021.109919 oligosaccharides by bacterial strains from human colon: in [35] Studier F.W., Protein production by auto-induction in high vitro and in vivo studies in gnotobiotic rats. J. Appl. Bacteriol. density shaking cultures. Protein Expr. Purif. 2005, 41, 1995, 79, 117–127. https://doi.org/10.1111/j.1365-2672.1995. 207–234. https://doi.org/10.1016/j.pep.2005.01.016 tb00924.x [36] Miller G.L., Use of dinitrosalicylic acid reagent for [23] Sarbini S.R., Kolida S., Naeye T., Einerhand A., Brison Y., determination of reducing sugar. Anal. Chem. 1959, 31, Remaud-Simeon M., et al., In vitro fermentation of linear and 426–428. https://doi.org/10.1021/ac60147a030 α-1,2 branched dextrans by the human faecal microbiota. [37] Piovesan D., Minervini G., Tosatto S.C., The RING 2.0 web Appl. Environ. Microbiol. 2011, 77, 5307–5315. https://doi. server for high quality residue interaction networks. Nucleic org/10.1128/AEM.02568-10 Acids Res. 2016, 44, W367–W374. https://doi.org/10.1093/ [24] Valette P., Pelenc V., Djouzi Z., Andrieux C., Paul F., Monsan P., nar/gkw315 et al., Bioavailability of new synthesised glucooligosaccharides in the intestinal tract of gnotobiotic rats. J. Sci. Food Agric. 1993, 62, 121–127. https://doi.org/10.1002/jsfa.2740620204 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Amylase de Gruyter

The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping

Download PDF
9 pages

Loading next page...
 
/lp/de-gruyter/the-role-of-the-c-domain-in-the-thermostability-of-gh70-enzymes-VYznIe0S96

References (37)

Publisher
de Gruyter
Copyright
© 2022 Manon Molina et al., published by De Gruyter
eISSN
2450-9728
DOI
10.1515/amylase-2022-0002
Publisher site
See Article on Publisher Site

Abstract

Amylase 2022; 6: 11–19 Research Article Manon Molina, Thomas Prévitali, Claire Moulis, Gianluca Cioci, Magali Remaud-Siméon* The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping https://doi.org/10.1515/amylase-2022-0002 Keywords: glucansucrase; branching sucrase; chimera; Received November 8, 2021; accepted January 25, 2022. GH70 enzymes; domain C; enzyme stability. Abstract: Sucrose-active enzymes belonging to the glycoside hydrolase (GH) family 70 are attractive tools Abbreviations for the synthesis of oligosaccharides, polysaccharides or glycoconjugates. However, their thermostability is an ASR, alternansucrase; CD, catalytic domain; DSF, important issue for the development of robust and cost- differential scanning fluorimetry; GBD, glucan binding effective enzyme-based processes. Indeed, GH70 enzymes domain; GH, glycoside hydrolase; T , melting temperature. are mesophilic and no thermophilic representatives have been described so far. Furthermore, structurally guided engineering is a challenge given the size of these 1 Introduction proteins (120 to 250 kDa) and their organization in five domains. Herein, we have investigated the possible role The alternansucrase (ASR) and the α-1,2 branching sucrase of the domain C in the stability of GH70 enzymes. The GBD-CD2 (GBD and CD stand for glucan binding domain alternansucrase (ASR) is the most stable enzyme of the and catalytic domain, respectively) are promising enzymes GH70 family. Structural comparison of ASR to other GH70 for the development of industrial applications including enzymes highlighted the compactness of its domain C. We polysaccharide, oligosaccharide or glycoconjugate assumed that this atypical structure might be involved synthesis via the glucosylation of many different acceptors in the stability of this enzyme and decided to introduce from sucrose substrate, an abundant and low-cost this domain in another much less stable GH70 enzyme resource [1-5]. These efficient α-transglucosylases belong of known three-dimensional structure, the branching to the family 70 of the glycoside hydrolases (GH) according sucrase GBD-CD2. The chimeric GBD-CD2 exhibited a lower to the CAZy classification [6]. They are both mesophilic specific activity on sucrose substrate but its specificity enzymes produced by lactic acid bacteria. was unchanged with the enzyme remaining specific for The ASR from Leuconostoc citreum NRRL B-1355 is the branching of dextran via α-1,2 linkage formation. one of the most stable enzymes of the GH70 family, with Interestingly, the chimera showed a higher melting an optimum temperature of 45 °C [7], and a half-time life temperature and residual activity than the wild-type of 75 hours at 30 °C and 6 hours at 40 °C determined for enzyme after 10 min incubation at 30 °C showing that the the recombinant enzyme [8]. This old-known enzyme domain C can affect GH70 enzyme stability and could be a has attracted interest because of the peculiarity of the potential target of both random or rational mutagenesis to high molar mass polymer it produces from sucrose and further improve their stability. which was named alternan because of the presence of alternative α-1,6 and α-1,3 linkages in the polymer main chain [9]. Thanks to its physico-chemical properties, the alternan polymer is a good candidate for replacing gum Arabic [10,11] and the oligoalternans have interesting prebiotic properties [12-14]. The three-dimensional *Corresponding author: Magali Remaud-Siméon, Toulouse Biotechnology Institute (TBI), Université de Toulouse, CNRS, INRAE, structure of a truncated variant of this glucansucrase INSA, 135, Avenue de Rangueil, CEDEX 04, F-31077 Toulouse, France, (ASRΔ2, comprising amino acids Ala29 to Gly1425; PDB ID: E-mail: remaud@insa-toulouse.fr 6HVG) revealed that ASR adopts a U-shaped fold formed Manon Molina, Thomas Prévitali, Claire Moulis, Gianluca Cioci, by five distinct domains A, B, C, IV and V like other GH70 Toulouse Biotechnology Institute (TBI), Université de Toulouse, enzymes [15-20]. Domains A, B, IV and V are made up by CNRS, INRAE, INSA, 135, Avenue de Rangueil, CEDEX 04, F-31077 Toulouse, France sequence fragments on either side of domain C [18]. Five Open Access. © 2022 Manon Molina et al., published by De Gruyter. This work is licensed under the Creative Commons Attribution 4.0 International License. 12  Manon Molina et al. other tertiary structures of ASRΔ2 were solved in complex 2 Results and discussion with different oligosaccharides (PDB IDs: 6SYQ, 6T1P, 6T16, 6SZI, 6T18). They enabled the identification of two 2.1 Structural comparison of domain C of sugar binding pockets (V-A and V-B) and revealed the GH70 enzymes presence of a unique oligosaccharide binding site at the surface of domain A [21]. The domain C was extracted from the whole tertiary The branching sucrase GBD-CD2 from Leuconostoc structure (Fig. 1A) for analysis. The structural comparison citreum NRRL B-1299 is an α-1,2 branching sucrase of the domain C of ASR with those of other GH70 sucrose that performs α-1,2 glucosylation of exogenous active enzymes (i.e. GTF180, GTF-SI, GTFA, GBD-CD2 and isomaltooligosaccharides or α-1,6 linked dextran using DSR-M) highlighted significant differences (Fig. 1B). First, sucrose as glucosyl donor. Up to 40% of α-1,2 osidic 882 890 ASR presents three peptide insertions: SSGKDLKDGE , linkages, a rare linkage in nature, can be introduced [4]. 913 916 996 1000 QDNS and KQDGT , insertion 1, 2 and 3, The resulting α-1,2 glucooligosaccharides are resistant to respectively in Figure 1. Notably, insertion 3 is part of a the hydrolysis by digestive enzymes from both humans β-hairpin (from Thr991 to Glu1005) and is only found in and animals and show prebiotic activity [22-24]. GBD-CD2 the ASR structure. is also an attractive tool for the glucosylation of other In addition, four ionic interactions can be predicted oligosaccharides or hydroxylated molecules. For instance, in the domain C of ASR against two for DSR-M, GTF-SI the wild-type enzyme and several mutants catalysed and GTF180 and none for GTFA and GBD-CD2. Similarly, the glucosylation of tetrasaccharides entering in the ASR domain C harbours seven π-π stacking interactions, composition of different oligosaccharidic motifs found in whereas only two or three are predicted for the others. Shigella flexneri O-antigens (notably in the serotypes 3a, 2b, Sequence alignment of the domain C of ASR and GBD-CD2 3a, 4a or 4b) and stand as interesting tools for the chemo- shows that the two domains share 49.64% of identity, while enzymatic synthesis of carbohydrate-based vaccines their extremities are highly conserved (Fig. 2). In addition, [25,26]. This enzyme was also successfully engineered the number of residues Ile, Val, Leu and Phe showing the for flavonoid glucosylation and several variants were highest hydrophobicity according to Kyte and Doolittle obtained, which increased naringenin conversion from scale [29] is higher in ASR than in GBD-CD2 domain C. Many 14% to 60% and morin from 20% to 67% compared to of them participate in a hydrophobic interface with domain the wild-type [27]. The three-dimensional structure of a A or into local hydrophobic cores of domain C (Figs 2 and 3). truncated version of GBD-CD2 (∆N -GBD-CD2) was solved All together, these specific structural features (i.e. in 2012 (PDB ID: 3TTQ). Two sugar binding pockets (V-L hydrophobic cores, hydrophobic interface, ionic or π-π and V-K) were structurally characterized in the domain V of stacking interactions) are likely to be important for the enzyme, confirming the designation “glucan binding protein folding and thermal stability, and let us assume domain” [28]. However, a limit to GBD-CD2 utilization is that the ASR domain C could be involved in the higher its relative poor stability, with a half-life time of 10 hours stability of this enzyme. So, we hypothesized that it could at 30 °C and only 15 minutes at 40 °C [4]. enhance the stability of GBD-CD2, known to be less stable Structural comparisons of ASR and GBD-CD2 further than ASR. To assess our hypothesis, we replaced the revealed that although the C-domain of ASR contains domain C of ΔN -GBD-CD2 by that of ASR. Importantly, longer loops, it also harbours a higher number of β-strands the design and the construction of this chimeric enzyme and a higher level of interactions than those found in GBD- were facilitated by the high level of conservation of the CD2. The C-domain is the only domain in GH70 enzymes amino acid sequences found at the N- and C-terminal consisting of a contiguous segment, forming a Greek key extremities of both domains C, limiting the risk of a motif at the bottom of the ‘U’ fold and acting as a pedestal. complete destabilization of the overall fold due to domain We therefore hypothesized that the greater compactness C swapping (Fig. 2; orange dotted boxes). of the ASR C-domain might enhance the thermostability of this enzyme. By analogy, the introduction of the ASR C-domain into the structure of GBD-CD2 could thus 2.2 Production of the chimeric enzyme increase the stability of the latter. It is this hypothesis that we wanted to study here by creating a chimeric protein Using the protocol of production previously optimized comprising domains A, B, IV, V of GBD-CD2 grafted onto for the wild-type enzyme ΔN -GBD-CD2 [31], the part of the C domain of ASR and by characterizing the biochemical enzyme recovered in the insoluble fraction as aggregates or properties of the chimera obtained. inclusion bodies was greater for the chimera (Fig. 4A). We The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  13 Figure 1: (A) View of the overall structure of ASR with the five domains: V (red), IV (yellow), B (green), A (blue) and C (purple). (B) Comparison of the domain C of available glucansucrase and branching sucrase structures. Figure 2: Sequence alignment of the domain C of ASR and GBD-CD2 (ASR: 873-1030, GBD-CD2: 2424-2562). Arrows indicate the residues that differ in GBD-CD2 and that are thought to be involved in ASR domain C stability or folding. Blue triangle: hydrophobic interface with domain A; orange star: ionic interaction; pink circle: local hydrophobic core; green diamond: π-π stacking interaction. Orange dotted boxes: high similarity between the N-terminal and C-terminal parts of domains C. Alignment created with ENDscript 2 [30]. therefore tested the production of the wild-type enzymes 2.3 Effect of domain C swapping on GBD-CD2 and the chimera in the presence of a chaperone protein specificity and thermal stability to facilitate protein folding. We used Escherichia coli BL21 star cells previously transformed with the commercial The specific activity of the ΔN -GBD-CD2-chimera was -1 -1 pTf16 plasmid harbouring the Tig chaperone. As shown in estimated at 11.6 U.mg , versus 16.9 U.mg for the wild-type Figure 4, the production of enzymes in the soluble fraction enzyme when tested on sucrose substrate only. With 69% increased and reached sufficient production levels to of residual activity compared to the wild-type enzyme, perform biochemical characterization (Fig. 4A). The ΔN - the ΔN -GBD-CD2-chimera was impacted by the domain 123 123 GBD-CD2-chimera was then purified and characterized to swapping but not to a major extent. compare its stability, efficiency and specificity with those Furthermore, H NMR spectra of the reaction products of the wild-type enzyme. To note, the Tig chaperone did obtained from sucrose and 70 kDa dextran with ΔN - not appear on the SDS-PAGE after purification (Fig. 4B). GBD-CD2 and ΔN -GBD-CD2-chimera are perfectly 14  Manon Molina et al. Figure 3: Residues involved in domain C packing. (A) View of ASR domain C hydrophobic residues (Ile, Val, Leu, Phe, Cys, Met, Ala) involved in the interface between domain A and C (Met878, Leu895, Ile924, Val926, Val928, Leu958, Val959, Ile966, Val968, Leu1013, Ile1014, Leu1018, Val1020 and Val1022). (B) View of the residues involved into ionic interactions in ASR domain C (Asp881-Lys940, Lys935-Glu1005, Asp963-Lys1007 and Asp970-Lys974). (C) View of the residues involved into local hydrophobic cores in ASR domain C (Leu894, Phe900, Ile904, Ile927, Leu934, Leu936, Ile942, Leu944, Met946, Ala949, Ala957, Leu960, Leu978, Leu986, Phe988, Phe994 and Met1006). (D) View of the residues involved into π-π stacking interactions in ASR domain C (Tyr919-His950, His950-Tyr955, Phe988-Phe994, Phe988- Trp1021, Phe994-Tyr1004, Phe994-Trp1021 and Tyr1004-Tyr1017). (E) View of the residues involved into local hydrophobic cores in GBD-CD2 domain C (Leu2472, Leu2474, Leu2436, Leu2498, Ile2465, Ala2495, Leu2482, Leu2523, Met2484, Ala2515, Val2480, Ile2530). (F) View of the residues involved into π-π stacking interactions in GBD-CD2 domain C (Tyr2549-Trp2553, His2488-Tyr2493). The oxygen, nitrogen and sulphur atoms are coloured in red, blue and yellow, respectively. The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  15 Figure 4: (A) SDS-PAGE electrophoresis with and without tig chaperone for ΔN -GBD-CD2 and ΔN -GBD-CD2-chimera. 1: Soluble fraction 123 123 ΔN -GBD-CD2; 2: soluble fraction ΔN -GBD-CD2-chimera; 3: soluble fraction ΔN -GBD-CD2 with tig chaperone; 4: soluble fraction 123 123 123 ΔN -GBD-CD2-chimera with tig chaperone; 5: insoluble fraction ΔN -GBD-CD2; 6: insoluble fraction ΔN -GBD-CD2-chimera; 7: insoluble 123 123 123 fraction ΔN -GBD-CD2 with Tig chaperone; 8: insoluble fraction ΔN -GBD-CD2-chimera with tig chaperone. (B) SDS-PAGE electrophoresis 123 123 of the purified ΔN -GBD-CD2. 1: purified fraction A3; 2: purified fraction A6. stackable (Fig. 5). The signals at 5.11 and 5.19 ppm are Another way to compare enzyme stability is the characteristic of the formation α-1,2 branching linkages in determination of the residual activity after a period of the linear dextran and their integration accounts for 36% incubation at a given temperature. After 10 minutes α-1,2 linkage in both cases. These results indicate that incubation at 30 °C, the percentage of residual activity was domain C swapping did not affect the enzyme specificity, of 53% and 36% for the chimera and the wild-type ΔN - namely its ability to branch dextran molecules with GBD-CD2, respectively. This difference is in agreement glucosyl units linked through α-1,2 linkage. with the DSF results and shows that the chimeric enzyme The melting temperatures of ΔN -GBD-CD2 and is slightly more resistant to temperature than its wild-type ΔN -GBD-CD2-chimera were determined by differential homologue suggesting that the domain C swapping has scanning fluorimetry (DSF) (Fig. 6). Both DSF curves slightly improved the stability of ΔN -GBD-CD2. revealed the presence of two peaks (A and B) corresponding to two melting temperatures (T ). The presence of different melting temperatures is often observed for multi-modular 3 Conclusion enzymes, such as the GH70 family enzymes. The first T (peak A) and the second one (peak B) correspond to T Studies focusing on stability improvement of GH70 values of 37.7 °C and 44.5 °C for the chimera versus 37.1 family enzymes using protein engineering are scarce. °C and 41.6 °C for the wild-type enzyme. The variation of One study reports the mutation of proline residues 0.6 °C and 2.9 °C for the two melting temperatures seems to serine or lysine to threonine in order to introduce to indicate that the chimeric enzyme is more stable than stabilizing hydrogen bonds in the dextransucrase from the wild-type ΔN -GBD-CD2, even if the increase of T Leuconostoc mesenteroides 0326 [32]. One mutant showed 123 m especially for the second peak must be taken with caution a 2-fold increase in catalytic efficiency, the same optimum due the bad peak resolution. temperature of 25 °C and a half-life time at 35 °C that increased from 6.6 minutes for the wild-type to 48.8 16  Manon Molina et al. Figure 5: H NMR spectra of ∆N -GBD-CD2 and its chimera. Reaction from 292 mM sucrose, 309 mM of 70 kDa dextran in 50 mM NaAc buffer pH 5.75 at 30 °C over a period of 24 hours. Figure 6: (A) Evolution of the relative fluorescence and (B) derivative of the relative fluorescence units (RFU) during the denaturation of ΔN - GBD-CD2 and ΔN -GBD-CD2-chimera. minutes for the mutant [32]. A second approach relied stability. The domain V was artificially extended using on disulphide bridge introduction in the dextransucrase ferredoxin as a suffix, and several truncations of this and resulted in the identification of mutants revealing a suffix were tested. The best improvement obtained was shift of the optimum temperature from 25 °C to 35 °C but an increase of half-life time of 280% and 200% at 35 °C no improvement of thermostability [33]. Very recently, and 45 °C, respectively. These recent results highlight engineering was performed on the C-terminal part of the potential of engineering domain V for stability [34], a dextransucrase dexYG domain V to improve the enzyme strategy that could be coupled to domain C engineering. The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  17 -1 -1 In this study, we performed an exchange of domain 100 µg.mL and chloramphenicol 20 µg.mL was used to C between two GH70 enzymes showing different thermal inoculate a culture at an OD of 0.05 in ZYM-5052 auto- 600nm stability. Indeed, we noticed that the domain C, found at inducible medium [35] modified by supplementation with -1 -1 the basis of U-shape structure, is more compact in the ASR 100 µg.mL ampicillin and 20 µg.mL chloramphenicol, -1 than in the GBD-CD2, our two model enzymes, and it was 4 mg.mL arabinose, 0.75%(w/v) α-lactose, 1.5%(w/v) suspected to be involved in the highest stability of the ASR glycerol and 0.05% glucose for ΔN -GBD-CD2 and ΔN - 123 123 compared to that of the GBD-CD2. To test this hypothesis, GBD-CD2 chimera production (conditions optimized we have successfully constructed and produced a chimeric previously [31]). After 24 hours at 23 °C, cells were enzyme, in which the domain C of GBD-CD2 was exchanged harvested by centrifugation and re-suspended in binding by that of ASR. Our results indicate that the branching buffer containing 20 mM phosphate buffer, 20 mM sucrase ΔN -GBD-CD2 has slightly increased in thermal imidazole (Merck Millipore), 500 mM NaCl and 50 mM stability after acquiring the domain C of ASR, without sodium acetate buffer pH 5.75. Final OD was 30. Cells 600nm modification of its specificity. Rigidification of domain were disrupted by sonication and debris was removed C could thus be an approach that might deserve further by a centrifugation step at 45,000 × g for 30 minutes at investigations to increase the GH70 enzyme stability. 8 °C. Purification was performed with ÄKTA Xpress system (GE Healthcare). Twenty mM imidazole and 500 mM NaCl were added to the soluble fraction prior to the purification of ΔN -GBD-CD2 and ΔN -GBD-CD2 123 123 4 Experimental procedures chimera. Two-step purification was performed in a cold chamber at 12 °C using: (i) a HisTrap HP 1 mL column (GE 4.1 Chimera design and construction Healthcare) for the affinity step; and (ii) a Superose12 16/60 (GE Healthcare) for the size exclusion step; and Clustal Omega (https://www.ebi.ac.uk/Tools/msa/ protein was eluted in MES buffer pH 6.5 at 30 mM with -1 clustalo/) was used to align ASR and GBD-CD2 sequence 100 mM NaCl and 0.05 g.L CaCl . Purified fractions were and Genome Compiler (http://www.genomecompiler.com/) pooled together and concentrated using AmiconUltra-15 -1 was used to construct and manipulate plasmid cards. with a cut-off of 50 kDa to 10-15 mg.mL . Purification was Domain C of ASR was amplified by PCR using pET53- checked by SDS-PAGE electrophoresis using NuPAGE asr-Δ2 as template, Phusion® polymerase (NEB), forward 3-8% Tris-Acetate protein gels (Invitrogen), and protein primer ACGGCTCGTAAAAGCTATGTCTCTGGTGGGCAAA- concentration was assessed by spectroscopy at 280 nm CAATG and reverse primer TGTACGGGCATCTTGATTGT- using a NanoDrop instrument. The theoretical molecular CACTAGCTCCAACTGGCACC. The underlined sequence weight and molar extinction coefficient of the enzymes corresponds to the overlap with ΔN -gbd-cd2 gene. were calculated using the ExPASy ProtParam tool (https:// Plasmid of pET53-ΔN -gbd-cd2 was amplified without the web.expasy.org/protparam/). The molecular weight is of domain C with the primers GACAATCAAGATGCCCGTACAG 127.56 kDa and 157.26 kDa for the GBD-CD2-chimera and and GACATAGCTTTTACGAGCCGTC. PCR products were ASR-chimera, respectively. Extinction coefficient is of -1 -1 purified with GenElute PCR Clean-up kit (Sigma) and DNA 196310 and 213730 M .cm for the GBD-CD2-chimera and was quantified using a NanoDrop instrument. Assemblage ASR-chimera, respectively. of ΔN -gbd-cd2 plasmid with asr-Δ2 domain C was made using NEBuilder HiFi DNA Assembly kit with a molar ratio vector:insert of 1:2. Ligation product was transformed in 4.3 Activity measurement home-made E. coli DH5α competent cells and sequences of the constructions were checked by sequencing (GATC). Activity was determined in triplicate at 30 °C in a Thermomixer (Eppendorf) using the 3,5-dinitrosalicylic acid method [36]. Fifty mM sodium acetate buffer pH 5.75, 4.2 Production and purification of chimera -1 292 mM sucrose and 0.002 mg.mL of pure ΔN -GBD-CD2 and wild-type enzymes enzyme were used. One unit of activity is defined as the amount of enzyme that hydrolyses 1 µmol of sucrose per The E. coli BL21 DE3* strain transformed with a plasmid minute. harbouring the Tf16 chaperone gene (Takara) was used for enzyme production. A pre-culture of transformed E. coli BL21 DE3* in LB medium supplemented with ampicillin 18  Manon Molina et al. 4.4 Enzymatic reactions and product Conflict of interest: The authors declare no conflict of interest. characterization ΔN -GBD-CD2 and ΔN -GBD-CD2 chimera branching 123 123 -1 reactions were performed using 1 U.mL of pure enzyme References with 292 mM sucrose and 309 mM of 70 kDa dextran in [1] Molina M., Cioci G., Moulis C., Séverac E., Remaud-Siméon 50 mM NaAc buffer pH 5.75 at 30 °C over a period of 24 M., Bacterial α-glucan and branching sucrases from GH70 hours. These polymers were purified by dialysis using 14 family: discovery, structure–function relationship studies kDa cut-off cellulose dialysis tubing (Sigma-Aldrich) in and engineering. Microorganisms 2021, 9, 1607. https://doi. water and analysed by NMR. NMR samples were prepared org/10.3390/microorganisms9081607 by dissolving 10 mg of purified product in 0.5 mL D O. [2] Bertrand A., Morel S., Lefoulon F., Rolland Y., Monsan P., Remaud-Simeon M., Leuconostoc mesenteroides glucansucrase Deuterium oxide was used as the solvent, and sodium synthesis of flavonoid glucosides by acceptor reactions 2,2,3,3-tetradeuterio-3-trimethylsilylpropanoate (TSPD ) in aqueous-organic solvents. Carbohydr. Res. 2006, 341, 1 13 was selected as the internal standard (δ H = 0 ppm, δ C 855–863. https://doi.org/10.1016/j.carres.2006.02.008 = 0 ppm). H spectra were recorded on a Bruker Avance [3] Grimaud F., Faucard P., Tarquis L., Pizzut-Serin S., Roblin P., 500-MHz spectrometer operating at 500.13 MHz. The Morel S., et al., Enzymatic synthesis of polysaccharide-based data were processed using TopSpin 3.0 software. One- copolymers. Green Chem. 2018, 20, 4012–4022. https://doi. org/10.1039/C8GC01251B dimensional H NMR spectra were acquired by using a [4] Brison Y., Fabre E., Moulis C., Portais J.C., Monsan P., Remaud- zgpr pulse sequence (with water suppression). Spectra Siméon M., Synthesis of dextrans with controlled amounts were performed at 298 K. of α-1,2 linkages using the transglucosidase GBD-CD2. Appl. Microbiol. Biotechnol. 2010, 86, 545–554. https://doi. org/10.1007/s00253-009-2241-z [5] Musa A., Miao M., Zhang T., Jiang B., Biotransformation of 4.5 Enzyme melting temperature stevioside by Leuconostoc citreum SK24.002 alternansucrase determination acceptor reaction. Food Chem. 2014, 146, 23–29. https://doi. org/10.1016/j.foodchem.2013.09.01 DSF experiments were performed in triplicates with 7 µM [6] Lombard V., Golaconda Ramulu H., Drula E., Coutinho P.M., of pure enzyme in 50 mM sodium acetate buffer pH 5.75 Henrissat B., The carbohydrate-active enzymes database -1 supplemented with 0.5 g.L of CaCl and 10 X of SYPRO (CAZy) in 2013. Nucleic Acids Res. 2014, 42, D490–D495. https://doi.org/10.1093/nar/gkt1178 orange (Life Technologies). A ramp from 20 °C to 80 °C [7] López-Munguía A., Pelenc V., Remaud M., Biton J., Michel J.M., was applied with 0.3 °C increments on a C1000 Thermal Lang C., et al., Production and purification of alternansucrase, Cycler apparatus from Bio-Rad. a glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355, for the synthesis of oligoalternans. Enzyme Microb. Technol. 1993, 15, 77–85. https://doi.org/10.1016/0141- 0229(93)90120-Q 4.6 Structural analysis of the enzymes [8] Joucla G., Caractérisation de l’alternane-saccharase de Leuconostoc mesenteroides NRRL B-1355: Approche rationnelle To analyse the network of interactions in the structure, et aléatoire pour la conception de nouvelles glucane- the RING [37] web server was used (Residue Interaction saccharases. Thèse de doctorat, Institut national des sciences Network Generator; http://protein.bio.unipd.it/ring). It appliquées de Toulouse, Toulouse, 2003. identifies and lists all the non-covalent interactions in the [9] Côté G.L., Robyt J.F., Isolation and partial characterization of an extracellular glucansucrase from Leuconostoc mesenteroides PDB loaded file (hydrogen bond, Van der Waals, ionic, π-π NRRL B-1355 that synthesizes an alternating (1→6),(1→3)-α-D- stacking, π-cation). glucan. Carbohydr. Res. 1982, 101, 57–74. https://doi. org/10.1016/S0008-6215(00)80795-8 Acknowledgments: We are grateful to the Engineering [10] Côté G.L., Low-viscosity α-d-glucan fractions derived from and Screening for Original Enzymes facility (ICEO) of sucrose which are resistant to enzymatic digestion. Carbohydr. Polym. 1992, 19, 249–252. https://doi.org/10.1016/0144- Toulouse Biotechnology Institute, which is part of the 8617(92)90077-4 Integrated Screening Platform of Toulouse, for access to [11] Leathers T.D., Nunnally M.S., Côté G.L., Modification of alternan HPLC and protein purification facilities. We also thank by dextranase. Biotechnol. Lett. 2009, 31, 289–293. https:// Dr. Sandrine Morel and the Metasys platform of TBI doi.org/10.1007/s10529-008-9866-3 (Toulouse,France) for the NMR experiments. [12] Côté G.L., Holt S.M., Miller-Fosmore C., Prebiotic oligosaccharides via alternansucrase acceptor reactions. ACS The role of the C domain in the thermostability of GH70 enzymes investigated by domain swapping  19 Symposium Series 2003, 849, 76–89. https://doi.org/10.1021/ [25] Hu Z., Benkoulouche M., Barel L.A., Le Heiget G., Ben bk-2003-0849.ch007 Imeddourene A., Le Guen Y., et al., Convergent chemoenzymatic [13] Holt S.M., Miller-Fosmore C.M., Côté G.L., Growth of strategy to deliver a diversity of Shigella flexneri serotype- various intestinal bacteria on alternansucrase-derived specific O-antigen segments from a unique lightly protected oligosaccharides. Lett. Appl. Microbiol. 2005, 40, 385–390. tetrasaccharide core. J. Org. Chem. 2021, 86, 2058–2075. https://doi.org/10.1111/j.1472-765X.2005.01681.x https://doi.org/10.1021/acs.joc.0c00777 [14] Sanz M.L., Côté G.L., Gibson G.R., Rastall R.A., Prebiotic [26] Benkoulouche M., Ben Imeddourene A., Barel L.A., Le properties of alternansucrase maltose-acceptor Heiget G., Pizzut S., Kulyk H., et al., Redirecting substrate oligosaccharides. J. Agric. Food Chem. 2005, 53, 5911–5916. regioselectivity using engineered ΔN -GBD-CD2 branching https://doi.org/10.1021/jf050344e sucrases for the production of pentasaccharide repeating units [15] Brison Y., Pijning T., Malbert Y., Fabre É., Mourey L., Morel S., of S. flexneri 3a, 4a and 4b haptens. Sci. Rep. 2021, 11, 2474. et al., Functional and structural characterization of α-(1→2) https://doi.org/10.1038/s41598-021-81719-1 branching sucrase derived from DSR-E glucansucrase. J. Biol. [27] Malbert Y., Moulis C., Brison Y., Morel S., André I., Remaud- Chem. 2012, 287, 7915–7924. https://doi.org/10.1074/jbc. Simeon M., Engineering a branching sucrase for flavonoid M111.305078 glucoside diversification. Sci. Rep. 2018, 8, 15153. https://doi. [16] Claverie M., Cioci G., Vuillemin M., Monties N., Roblin org/10.1038/s41598-018-33394-y P., Lippens G., et al., Investigations on the determinants [28] Brison Y., Malbert Y., Czaplicki G., Mourey L., Remaud-Simeon responsible for low molar mass dextran formation by DSR-M M., Tranier S., Structural insights into the carbohydrate- dextransucrase. ACS Catal. 2017, 7, 7106–7119. https://doi. binding ability of an α-(1→2) branching sucrase from glycoside- org/10.1021/acscatal.7b02182 hydrolase family 70. J. Biol. Chem. 2016, 7527–7540. https:// [17] Ito K., Ito S., Shimamura T., Weyand S., Kawarasaki Y., Misaka doi.org/10.1074/jbc.M115.688796 T., et al., Crystal structure of glucansucrase from the dental [29] Kyte J., Doolittle R.F., A simple method for displaying the caries pathogen Streptococcus mutans. J. Mol. Biol. 2011, 408, hydropathic character of a protein. J. Mol. Biol. 1982, 157, 177–186. https://doi.org/10.1016/j.jmb.2011.02.028 105–132. https://doi.org/10.1016/0022-2836(82)90515-0 [18] Molina M., Moulis C., Monties N., Pizzut-Serin S., Guieysse [30] Robert X., Gouet P., Deciphering key features in protein D., Morel S., et al., Deciphering an undecided enzyme: structures with the new ENDscript server. Nucleic Acids Res. investigations of the structural determinants involved in the 2014, 42, W320–W324. https://doi.org/10.1093/nar/gku316 linkage specificity of alternansucrase. ACS Catal. 2019, 9, [31] Vuillemin M., Malbert Y., Laguerre S., Remaud-Siméon M., 2222–2237. https://doi.org/10.1021/acscatal.8b04510 Moulis C., Optimizing the production of an α-(1→2) branching [19] Pijning T., Vujičić-Žagar A., Kralj S., Dijkhuizen L., Dijkstra BW., sucrase in Escherichia coli using statistical design. Appl. Structure of the α-1,6/α-1,4-specific glucansucrase GTFA from Microbiol. Biotechnol. 2014, 98, 5173–5184. https://doi. Lactobacillus reuteri 121. Acta Crystallogr. Sect. F Struct. Biol. org/10.1007/s00253-014-5627-5 Cryst. Commun. 2012, 68, 1448–1454. https://doi.org/10.1107/ [32] Li M.Q., Zhang H.B., Li Y., Hu X.Q., Yang J.W., The thermoduric S1744309112044168 effects of site-directed mutagenesis of proline and lysine [20] Vujicic-Zagar A., Pijning T., Kralj S., López C.A., Eeuwema on dextransucrase from Leuconostoc mesenteroides 0326. W., Dijkhuizen L., et al., Crystal structure of a 117 kDa Int. J. Biol. Macromol. 2018, 107, 1641–1649. https://doi. glucansucrase fragment provides insight into evolution org/10.1016/j.ijbiomac.2017.10.023 and product specificity of GH70 enzymes. Proc. Natl. Acad. [33] Zhang Y., Yang J., Yu X., Hu X., Zhang H., Engineering Sci. USA 2010, 107, 21406–21411. https://doi.org/10.1073/ Leuconostoc mesenteroides dextransucrase by inserting pnas.1007531107 disulfide bridges for enhanced thermotolerance. Enzyme [21] Molina M., Moulis C., Monties N., Guieysse D., Morel S., Microb. Technol. 2020, 139, 109603. https://doi.org/10.1016/j. Cioci G., et al., A specific oligosaccharide-binding site in enzmictec.2020.109603 the alternansucrase catalytic domain mediates alternan [34] Zhang Y.X., Yang J.W., Wu Y.Y., Hu X.Q., Zhang H.B., The elongation. J. Biol. Chem. 2020, 295, 9474–9489. https://doi. stability improvement of dextransucrase by artificial extension org/10.1074/jbc.RA120.013028 modification of the V domain of the enzyme. Enzyme Microb. [22] Djouzi Z., Andrieux C., Pelenc V., Somarriba S., Popot F., Technol. 2021, 151, 109919. https://doi.org/10.1016/j. Paul F., et al., Degradation and fermentation of α-gluco- enzmictec.2021.109919 oligosaccharides by bacterial strains from human colon: in [35] Studier F.W., Protein production by auto-induction in high vitro and in vivo studies in gnotobiotic rats. J. Appl. Bacteriol. density shaking cultures. Protein Expr. Purif. 2005, 41, 1995, 79, 117–127. https://doi.org/10.1111/j.1365-2672.1995. 207–234. https://doi.org/10.1016/j.pep.2005.01.016 tb00924.x [36] Miller G.L., Use of dinitrosalicylic acid reagent for [23] Sarbini S.R., Kolida S., Naeye T., Einerhand A., Brison Y., determination of reducing sugar. Anal. Chem. 1959, 31, Remaud-Simeon M., et al., In vitro fermentation of linear and 426–428. https://doi.org/10.1021/ac60147a030 α-1,2 branched dextrans by the human faecal microbiota. [37] Piovesan D., Minervini G., Tosatto S.C., The RING 2.0 web Appl. Environ. Microbiol. 2011, 77, 5307–5315. https://doi. server for high quality residue interaction networks. Nucleic org/10.1128/AEM.02568-10 Acids Res. 2016, 44, W367–W374. https://doi.org/10.1093/ [24] Valette P., Pelenc V., Djouzi Z., Andrieux C., Paul F., Monsan P., nar/gkw315 et al., Bioavailability of new synthesised glucooligosaccharides in the intestinal tract of gnotobiotic rats. J. Sci. Food Agric. 1993, 62, 121–127. https://doi.org/10.1002/jsfa.2740620204

Journal

Amylase – de Gruyter

Published: Jan 1, 2022

Keywords: glucansucrase; branching sucrase; chimera; GH70 enzymes; domain C; enzyme stability

There are no references for this article.