Access the full text.
Sign up today, get DeepDyve free for 14 days.
K. Jaaback, N. Johnson, Theresa Lawrie (2016)
Intraperitoneal chemotherapy for the initial management of primary epithelial ovarian cancer.The Cochrane database of systematic reviews, 1
Yanping, Guo, Geoffrey, N., Skiar, Andrew, Borkowski, Natasha, Kyprianou (2005)
Loss of the Cyclin-dependent Kinase Inhibitor 27Kq Protein in Human Prostate Cancer Correlates with Tumor Grade’
M. Grassi, C. Palma, C. Thomé, G. Lanfredi, A. Poersch, V. Faça (2017)
Proteomic analysis of ovarian cancer cells during epithelial-mesenchymal transition (EMT) induced by epidermal growth factor (EGF) reveals mechanisms of cell cycle control.Journal of proteomics, 151
T. Hashimoto, N. Yanaihara, A. Okamoto, T. Nikaido, M. Saito, S. Takakura, M. Yasuda, H. Sasaki, K. Ochiai, Tadao Tanaka (2011)
Cyclin D1 predicts the prognosis of advanced serous ovarian cancer.Experimental and therapeutic medicine, 2 2
V. Ramu, Martin Gill, Paul Jarman, D. Turton, Jim Thomas, Amitava Das, C. Smythe (2015)
A Cytostatic Ruthenium(II)-Platinum(II) Bis(terpyridyl) Anticancer Complex That Blocks Entry into S Phase by Up-regulating p27(KIP1).Chemistry, 21 25
M. Nishino, J. Jagannathan, N. Ramaiya, A. Abbeele (2010)
Revised RECIST guideline version 1.1: What oncologists want to know and what radiologists need to know.AJR. American journal of roentgenology, 195 2
(2017)
Philadelphia (PA): AACR
Mudan Lu, You Wang, Fei Xu, J. Xiang, Daozhen Chen (2015)
The prognostic of p27kip1 in ovarian cancer: a meta-analysisArchives of Gynecology and Obstetrics, 293
Lindsey Torre, B. Trabert, C. DeSantis, K. Miller, G. Samimi, C. Runowicz, M. Gaudet, A. Jemal, R. Siegel (2018)
Ovarian cancer statistics, 2018CA: A Cancer Journal for Clinicians, 68
Yan Gao, Jacson Shen, E. Choy, H. Mankin, F. Hornicek, Z. Duan (2017)
Inhibition of CDK4 sensitizes multidrug resistant ovarian cancer cells to paclitaxel by increasing apoptosissCellular Oncology, 40
V. Masciullo, A. Sgambato, C. Pacilio, B. Pucci, G. Ferrandina, J. Palazzo, A. Carbone, A. Cittadini, S. Mancuso, G. Scambia, A. Giordano (1999)
Frequent loss of expression of the cyclin-dependent kinase inhibitor p27 in epithelial ovarian cancer.Cancer research, 59 15
Baoying Hu, L. Hua, Wen-Kai Ni, Miaomiao Wu, Daliang Yan, Yuyan Chen, Cuihua Lu, Buyou Chen, C. Wan (2017)
Nucleostemin/GNL3 promotes nucleolar polyubiquitylation of p27kip1 to drive hepatocellular carcinoma progression.Cancer letters, 388
A. Mazumdar, Jamal Hill, Yun Zhang, L. Bollu, A. Tsimelzon, Jenny Chang, G. Mills, P. Brown (2017)
Abstract 5525: Induced expression of PPM1A in ER-negative breast cancer cells inhibits growth by suppressing CDK phosphorylationCancer Research, 77
Hui Liu, Yuan Liu, Z. Bian, Jing Zhang, Rui Zhang, Xiaoyu Chen, Yanxia Huang, Yang Wang, Jinshui Zhu (2018)
Circular RNA YAP1 inhibits the proliferation and invasion of gastric cancer cells by regulating the miR-367-5p/p27 Kip1 axisMolecular Cancer, 17
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
Mahmoud Bakr, S. Guan, N. Firth, Brisbane, Australia (2018)
Cyclin D1 and P27KIP1: The Gatekeepers of Dysplasia, 2
Shira Ronen, Daniel Abbott, O. Kravtsov, A. Abdelkader, Yayun Xu, A. Banerjee, K. Iczkowski (2017)
PTEN loss and p27 loss differ among morphologic patterns of prostate cancer, including cribriform.Human pathology, 65
M. Hafez, Ali Alhoshani, K. Al-hosaini, S. AlSharari, Salim Rejaie, M. Sayed-Ahmed, O. Al‐shabanah (2015)
SKP2/P27Kip1 pathway is associated with Advanced Ovarian Cancer in Saudi Patients.Asian Pacific journal of cancer prevention : APJCP, 16 14
W. Li, G. Zhang, Wang Hl, Leiping Wang (2016)
Analysis of expression of cyclin E, p27kip1 and Ki67 protein in colorectal cancer tissues and its value for diagnosis, treatment and prognosis of disease.European review for medical and pharmacological sciences, 20 23
U. Asghar, A. Witkiewicz, N. Turner, E. Knudsen (2015)
The history and future of targeting cyclin-dependent kinases in cancer therapyNature Reviews Drug Discovery, 14
J. Prat (2015)
FIGO's staging classification for cancer of the ovary, fallopian tube, and peritoneum: abridged republicationJournal of Gynecologic Oncology, 26
Martina Cusan, Giorgia Mungo, Mara Zompit, I. Segatto, B. Belletti, G. Baldassarre (2018)
Landscape of CDKN1B Mutations in Luminal Breast Cancer and Other Hormone-Driven Human TumorsFrontiers in Endocrinology, 9
A. Bali, P. O’Brien, L. Edwards, R. Sutherland, N. Hacker, S. Henshall (2004)
Cyclin D1, p53, and p21Waf1/Cip1 Expression Is Predictive of Poor Clinical Outcome in Serous Epithelial Ovarian CancerClinical Cancer Research, 10
Michael Thwaites, M. Cecchini, D. Passos, I. Welch, F. Dick (2016)
Interchangeable Roles for E2F Transcriptional Repression by the Retinoblastoma Protein and p27KIP1–Cyclin-Dependent Kinase Regulation in Cell Cycle Control and Tumor SuppressionMolecular and Cellular Biology, 37
Leah Randles, R. Anchoori, R. Roden, K. Walters (2016)
The Proteasome Ubiquitin Receptor hRpn13 and Its Interacting Deubiquitinating Enzyme Uch37 Are Required for Proper Cell Cycle Progression*The Journal of Biological Chemistry, 291
A. Pessentheiner, H. Pelzmann, E. Walenta, M. Schweiger, Lukas Groschner, W. Graier, D. Kolb, K. Uno, Toh Miyazaki, A. Nitta, D. Rieder, A. Prokesch, J. Bogner-Strauss (2013)
A novel RB E3 Ubiquitin Ligase (NRBE3) promotes cancer cell proliferation through a regulation loop with RB/E2F1Journal of Biological Chemistry
A. Psyrri, A. Bamias, Ziwei Yu, P. Weinberger, M. Kassar, S. Markakis, D. Kowalski, E. Efstathiou, R. Camp, D. Rimm, M. Dimopoulos (2005)
Subcellular Localization and Protein Levels of Cyclin-Dependent Kinase Inhibitor p27 Independently Predict for Survival in Epithelial Ovarian CancerClinical Cancer Research, 11
M. Kartal-Yandim, A. Adan-Gokbulut, Y. Baran (2016)
Molecular mechanisms of drug resistance and its reversal in cancerCritical Reviews in Biotechnology, 36
Thomas Schmittgen, K. Livak (2008)
Analyzing real-time PCR data by the comparative CT methodNature Protocols, 3
V. Masciullo, G. Ferrandina, Bruna Pucci, F. Fanfani, S. Lovergine, J. Palazzo, Gianfranco Zannoni, S. Mancuso, Giovanni Scambia, Antonio Giordano (2000)
p27Kip1 expression is associated with clinical outcome in advanced epithelial ovarian cancer: multivariate analysis.Clinical cancer research : an official journal of the American Association for Cancer Research, 6 12
T. Otto, P. Sicinski (2017)
Cell cycle proteins as promising targets in cancer therapyNature Reviews Cancer, 17
P. Dahm-Kähler, C. Borgfeldt, E. Holmberg, Christian Staf, H. Falconer, M. Bjurberg, P. Kjölhede, P. Rosenberg, K. Stålberg, T. Högberg, E. Åvall-Lundqvist (2017)
Population-based study of survival for women with serous cancer of the ovary, fallopian tube, peritoneum or undesignated origin - on behalf of the Swedish gynecological cancer group (SweGCG).Gynecologic oncology, 144 1
A. Oza, A. Cook, J. Pfisterer, A. Embleton, J. Ledermann, E. Pujade-Lauraine, G. Kristensen, M. Carey, P. Beale, A. Cervantes, T. Park-Simon, G. Rustin, F. Joly, M. Mirza, M. Plante, M. Quinn, A. Poveda, G. Jayson, D. Stark, A. Swart, L. Farrelly, R. Kaplan, M. Parmar, T. Perren (2015)
Standard chemotherapy with or without bevacizumab for women with newly diagnosed ovarian cancer (ICON7): overall survival results of a phase 3 randomised trialThe Lancet. Oncology, 16
Sourav Kalra, G. Joshi, A. Munshi, Raj Kumar (2017)
Structural insights of cyclin dependent kinases: Implications in design of selective inhibitors.European journal of medicinal chemistry, 142
H. Togt (2003)
Publisher's NoteJ. Netw. Comput. Appl., 26
(2018)
Loss of p27 expression in endometrial carcinoma patients with recurrent tumor is significantly associated with poor survival
J. Al-Maghrabi, Eman Emam, Wafaey Gomaa, M. Saggaf, A. Buhmeida, M. Al-Qahtani, M. Al-Ahwal (2015)
c-MET immunostaining in colorectal carcinoma is associated with local disease recurrenceBMC Cancer, 15
K. Lu, Jing-xuan Wang, Ying Song, Shu Zhao, Hang Liu, D. Tang, B. Pan, Hong Zhao, Qingyuan Zhang (2015)
miRNA-24-3p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting p27Kip1.Oncology reports, 34 2
(2010)
Van den Abbeele AD. Revised RECIST guideline version 1.1: what oncologists want to know and what radiologists need to know
G. Melmed, L. Kwan, K. Reid, M. Litwin (2002)
Quality of life at the end of life: trends in patients with metastatic prostate cancer.Urology, 59 1
Background: Ovarian cancer is the most common gynecological malignancy. In patients with advanced ovarian kip1 cancer, some biological parameters have prognostic implementations. P27 is an inhibitor of a cycline-dependent kinase, its loss, can contribute to tumor progression. KIP1 Objective: This study aimed to examine the importance of P27 protein in predicting the prognosis and response to neoadjuvant chemotherapy in patients with advanced ovarian epithelial cancer and to compare the outcomes of immunohistochemistry with Quantitative Real-time PCR. KIP1 Patients and methods: We have studied P27 expression by both immunohistochemistry and Quantitative Real- time PCR from 88 patients with advanced ovarian carcinomas undergone radical debulking surgery and received Paclitaxel followed by Cisplatin every 3 weeks for a total of 6 cycles. We also studied their association with both chemotherapy response and patient survival. KIP1 Results: Nuclear expression of p27 protein was intense in 86 normal ovarian tissues and 42 of 88 carcinomas. kip1 The P27 mRNA expression level by qRT-PCR was very low in ovarian cancer tissues relative to its adjacent KIP1 normal tissues. The results were statistically significant by both methods of determination. p27 expression was significantly related to good prognostic parameters as low stage tumors, differentiated tumors, absence of ascites, residual disease < 2 cm, and response to chemotherapy but not with histopathological type in case kip1 of determination by immunohistochemistry. Comparison of P27 by both immunohistochemistry and qRT- PCR with different prognostic parameters revealed no significant difference between both methods in the assessment of these parameters. In 4 years of follow-up, 20.5% of patients were alive without evidence of disease. 6.8% were alive with disease. The disease-related four -year survival rate for the whole group was 28.2%. In multivariate analysis, residual disease, histological type, tumor differentiation, ascites was of independent prognostic significance. Conclusion: In ovarian cancer, patients with loss of p27KIP1 expression are at a greater likelihood of disease KIP1 progression, p27 may be used as a molecular marker to predict response to chemotherapy and prognosis. KIP1 Both immunohistochemistry and qRT-PCR have equal reliability in the determination of p27 . Kip1 Keywords: Ovarian cancer, p27 , Immunohistochemistry, RT-PCR, Chemotherapy * Correspondence: whelsawy@gmail.com Clinical Oncology Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt Full list of author information is available at the end of the article © The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 2 of 9 Introduction results, making it hard to carefully delineate the role of Epithelial ovarian cancer is the most fatal gynecological particular genes in the potential development and pro- malignancy in developing countries [1]. Approximately gression of EOC [8]. Several trials have sufficiently KIP1 80% of patients are diagnosed with an advanced stage shown that p27 is properly a promising molecular [2], which is associated with a 5-year survival rate of marker of the poor prognosis in several cancers [9–13]. only 30%. This, despite improvements in long-term sur- vival, obtained through the use of combination chemo- Patients and methods therapy, mainly with cisplatin and lately with paclitaxel Patients [3]. Several factors attribute to the bad prognosis of pa- This study comprises 88 patients with the International tients with an advanced stage ovarian carcinoma, includ- Gynecology and Obstetrics Federation (FIGO) [14] stage ing the inability to perform complete cytoreductive III epithelial cancer ovary confirmed histopathologically surgery to eradicate the metastatic disease in > 75% of between May 2012 and April 2019. All patients under- patients, underlying resistant to chemotherapy in over went initial debulking surgery within 6 weeks before half of these patients and the emergence of chemoresis- chemotherapy. Written informed consent has been ob- tance in approximately half of the originally sensitive pa- tained from all cases included. The minimum age for ac- tients [4]. Although clinical-pathological characteristics tive recruitment in the study was at least 18 years of age. of ovarian cancer other than the stage of the disease, All patients had a normal blood picture, renal and hep- such as residual disease size following debulking surgery, atic function at the entry of the study. The study was ap- histological grade and type, lymph node status and the proved by the Committee of Ethics of research, Zagazig existence of ascites are additionally of proven prognostic University. Informed consent was obtained from all par- value, individual patients may show considerable chemo- ticipating patients before enrollment in the study. sensitivity variations although they share the same Exclusion criteria included patients with ovarian low clinical-pathological characteristics [5]. The pathogenesis malignant potential tumors; poor performance status of of most human cancers involved dysregulation of normal over 2 Eastern Cooperative Oncology Groups (ECOG) cell cycle control. Abnormal expressions of regulatory [15]; estimated glomerular filtration rate (GFR) of less proteins that regulate G1-S phase transition are fre- than 60 mL/minute; severe neuropathy; prior chemo- quently noticed as a critical, rate-limiting step in the therapy or radiotherapy for ovarian cancer and congest- progression of the cell cycle. G1-S transformation in- ive heart failure or arrhythmias. volves phosphorylation of the retinoblastoma protein pRb, leading to the production of transcription factors in Management the E2F family, which activate genes necessary for entry Postoperative chemotherapy comprised Paclitaxel 175 into the S phase [6]. PRb phosphorylation is launched by mg/m2 IV over 3 h followed by Cisplatin 75 mg/m2 IV complexes of cyclin D1/(CDK)4–6 and ended in late G1 infusion after vigorous hydration was typically adminis- by cyclin E/CDK2. Changes in the expression of cyclin tered every 3 weeks for 6 cycles for all patients included and/or cycline-dependent kinase (CDK) lead to en- in the study. Gynecological examination, abdominopelvic hanced cell proliferation and are undoubtedly believed ultrasonography, CA-125 assay were performed monthly. to contribute to malignancy. Also, down-regulation or Other radiological studies, such as CT or MRI of the ab- inactivation of CDK inhibitors, including p21Waf1/Cip1, domen and pelvis, were performed before chemotherapy Kip1 p27 , and p16Ink4a, usually causing G1 arrest by and every two-month if typically needed for Clinical re- binding to cyclin-CDK complexes, is frequently found in sponse evaluation according to the revised RECIST (Re- various human tumors, making sufficiently the cell vul- sponse Evaluation Criteria in Solid Tumors) criteria [16]. nerable to uncontrolled extracellular proliferation signals Four weeks after the 6th cycle of chemotherapy, pa- further [7]. Several trials have found expression in epi- tients with a clinical complete response underwent a thelial ovarian cancer (EOC) of these critical cell cycle laparoscopy. In laparoscopy negative cases, a laparotomy regulatory proteins. Despite frequent detection of alter- was performed to evaluate the pathological response by ations in expression levels, there are many conflicting re- multiple biopsies. After pathological assessment of biop- sults, making it hard to delineate the role of individual sies, patients were properly assigned to one of three genes in the development and progression of EOC [8]. groups: complete response, partial response with the KIP1 Several trials have shown that p27 is a promising microscopic disease only, and persistent disease. molecular marker of the poor prognosis in several can- cers [9–13]. Several trials have detected an expression in Immunohistochemistry epithelial ovarian cancer (EOC) of this critical cell cycle Immunohistochemistry was performed as mentioned regulatory protein. Despite frequent detection of alter- previously [17]. Briefly, Six-micron sections were cut ations in expression levels, there are many conflicting from formalin-fixed paraffin-embedded tissue blocks, Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 3 of 9 kip1 deparaffinized in xylene, and rehydrated. For antigen re- Quantitative real time-PCR of P27 mRNA gene KIP1 trieval and detection of p27 , the sections were heated expression in a microwave oven for a total of 30 min (three cycles One microgram of RNA was transcribed reversely of 10 min each) in 10 mmol/L sodium citrate buffer at using the (QuantiTect Reverse Transcription Kit) as pH 6.0. Endogenous peroxidase activity was eliminated instructed by the manufacturer. P27kip1 expression by preincubation in 2% H2O2 in methanol for 30 min was evaluated by quantitative real-time PCR (qRT- followed by three washes in phosphate-buffered saline PCR) using the following primers: P27 kip1 forward (PBS). The sections were stained using standard strepta- primer: GGCTTTCAGATTCCCAACTT and P27 kip1 vidin-biotin complex immunoperoxidase methods (Santa reverse primer: AGCCTCCCCACTCTCGTCT and Cruz Biotechnology, Santa Cruz, CA) on a Ventana ES ma- ABL forward primer: AGTCTCAGGATGCAGGTGCT chine (Ventana Medical Systems, Tucson, AZ). The pri- and ABL reverse primer: TAGGCTGGGGCTTT KIP1 mary antibodies for p27 were NCL-P27 monoclonal TTGTAA as ABL has been regarded to be a house- antibody (1:40). All antibodies were diluted in PBS contain- keeping gene. ing 1% normal rabbit serum. Peroxidase activity was local- PCR amplification was conducted in 25 μlof 12.5 μl2x ized with chromogen 3,3′-diaminobenzidine tetrachloride QuantiFast SYBR Green PCR Master Mix, 1 μMof in 0.5 mmol/L Tris buffer. The slides were counterstained each primer and 2 μl of cDNA under the following with Delafield’s hematoxylin. Normal ovarian tissue served circumstances: KIP1 as a positive control for p27 immunostaining. Thermal cycling conditions for each reaction included an initial hold at ninety-five °C for ten minutes, followed by forty denaturation cycles at ninety-five °C for ten Kip1 p27 scoring seconds and annealing/extension at sixty °C for thirty Samples were coded and the percentage of immuno- seconds. Fold change in the expression of mRNA of can- stained cells was assessed. Expression was categorized as cerous and normal control tissue samples was obtained positive (staining in ≥5% of cells) or negative (staining in kip1 using the Livak method. P27 expression level was de- < 5% of cells) as described previously. At least 20 high- termined by Stratagene, MX3000P Quantitative PCR power fields were selected randomly and 2000 cells were System (Agilent Technologies), and evaluated using counted [18]. MxPro QPCR Software (Agilent Technologies). The kit was provided by QIAGEN, Valencia, CA, USA. The −ΔΔCT Quantitative real-time polymerase chain reaction 2 method [19] was used to calculate the relative RNA extraction level of gene expression compared to the β-actin house- RNA extraction The extraction of total RNA from tissue keeping control. samples (normal and cancerous ovarian tissue) was per- formed using the RNase Kit (Qiagen, Germany). The Statistical analysis purity and concentration of RNA were verified by evalu- Analysis of the data was implemented using the SPSS ating the optical density (OD) at 260 and 280 nm using a Statistics 16.0 (SPSS Inc., Chicago, IL, USA) and Graph spectrophotometer with an acceptable A260/A280 ratio Pad Prism 6.07 software (La Jolla, CA, USA). of 1.8 to 2.1. KIP1 Fig. 1 Histological sections showing p27 immunostaining in serous carcinoma representative of a high expression shows > 50% nuclear KIP1 reactivity for p27 in malignant epithelial cells. a ×100 and b × 400, Scale bar: 100 μm Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 4 of 9 Results normal adjacent ovarian tissues, the mRNA ranged be- kip1 P27 expression tween 5.6 and 15.35 with a mean ± SD level of 10.098 ± kip1 P27 has been analyzed using immunohistochemis- 2.716. The difference between both groups was statisti- try and quantitative real-time PCR. Immunoreactivity cally significant (t = 31.682, p < 0.001) (Fig. 2b). KIP1 for P27 antigens has shown nuclear staining and weak cytoplasmic staining. Nuclear expression of kip1 KIP1 P27 , clinical, and pathological characteristics p27 protein was intense in 86 normal adjacent In the present study, the mean age of the patients was ovarian tissues (NAOT) and in 42 of 88 carcinomas 44 ± 10.3 years (range 21–66 years). Sixty-six (75%) pa- (ECO) (47.7%), the difference between both groups tients had an initial stage IIIC; 58 (65.9%) had moderate was statistically significant (t = 6.811, p < 0.001) (Fig. 1 or poorly differentiated tumors. Serous carcinomas were and Fig. 2 a). kip1 the most prevalent pathological type (75%) and ascites The P27 mRNA expression level by qRT-PCR in were present in 60 (68.2%) patients. After initial debulking malignant ovarian tissues ranged between 0.001and surgery, 56 patients (63.6%) had a residual disease greater 1.914 with a mean ± SD level of 0.743 ± 0.54 while in the KIP1 Fig. 2 P27 kip1 expressions in ovarian cancer tissues and their normal adjacent ovarian tissues. a Number of patients with P27 positive and KIP1 negative immunostaining (P < 0.001). b Epression levels of mRNA P27 in ovarian cancer tissues and their adjacent normal tissues by RT-PCR (P < 0.0001) Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 5 of 9 than 2 cm in size. After chemotherapy, forty-six patients prognostic parameters as analysis with immunohisto- (52.3%) achieved a treatment response (Table 1). chemistry but including the histopathological type kip1 P27 was studied with the clinical and pathological (Table 1). kip1 data of the patients. According to P27 immunoreactiv- Statistical evaluation of the patients with positive ity, we observed a statistically significant relation between P27 immunostaining and upregulation by RT-PCR kip1 P27 expression and non-expression by immunohisto- with each of the clinical and pathological parameters chemistry and FIGO stage, tumor grade, the presence or revealed no significant difference between both tech- absence of ascites, residual tumors after surgery and re- niques and all parameters (Table 2). Meanwhile, ana- sponse to chemotherapy. No difference was observed be- lysis of the patients according to their P27 expression tween the serous and non-serous pathological types or non-expression by IHC and according to up or (Table 1). When analyzing the clinical and pathological downregulation by RT-PCR and each of clinical and kip1 data with P27 upregulation and downregulation by pathological parameters revealed a significant correl- qRT-PCR, we found a statistically significant difference ation with each parameter (Table 2). KIP1 between all clinical and pathological data and up or down Comparison of P27 expression by both immuno- P27kip1 regulation (Table 1). histochemistry and qRT-PCR with each subcategory of different prognostic parameters revealed no significant kip1 P27 and prognostic parameters difference between both methods in the assessment of kip1 Expression of P27 by immunohistochemistry was as- these parameters (Table 3). sociated with good prognostic parameters as low stage KIP1 tumors (P = 0.040), differentiated tumors (P < 0.001), ab- P27 and patients survival sence of ascites (P < 0.001), residual disease < 2 cm During 4 years of follow-up, 18 patients (20.5%) were (P < 0.001) and response to chemotherapy (P = 0.004) alive without evidence of disease; six were alive with but was uncorrelatedwith the histopathological type disease (6.8%), whereas 64 had died of ovarian cancer kip1 (Table 1). Measurement of P27 mRNA by qRT-PCR (72.7%). The disease-related 4-year survival rate for revealed statistically significant upregulation with all the whole group was 28.2%. The median progression- KIP1 Table 1 Relation of expression of P27 by Immunohistochemistry and RT-PCR and clinical and pathological data IHC mRNA P27 P27 + ve P27 -ve Upregulation of P27 Downregulation of P27 N % N % t-test P N % N % t-test P Stage IIIA 8 80 2 20 2.4 0.04 8 80 2 20 2.372 0.042 IIIB 10 83.3 2 16.7 3.09 0.01 10 83.3 2 16.7 3.093 0.01 IIIC 24 36.3 42 63.7 2.32 0.02 24 36.3 42 63.7 2.315 0.024 Grade Moderate + Well differentiated 26 86.7 4 13.3 5.92 < 0.001 26 86.7 4 13.3 5.92 < 0.001 Poorly differentiated 16 27.6 42 72.4 3.82 < 0.001 16 27.6 42 72.4 3.816 < 0.001 Pathology Serous 38 61.3 24 38.7 1.83 0.07 40 62.5 24 37.5 2.066 0.043 Non- serous 4 15.4 22 84.6 4.89 < 0.001 2 8.3 22 91.7 7.405 < 0.001 Ascites Absent 24 85.7 4 14.3 5.92 < 0.001 24 85.7 4 14.3 5.396 < 0.001 Present 18 30 42 70 3.38 0.00 14 23.3 46 76.7 4.892 < 0.001 Response CR, Microscopic disease, PR 40 87 6 13 7.46 < 0.001 41 89.1 5 10.9 8.509 < 0.001 No response or progressive disease 2 4.8 40 95.2 13.7 < 0.001 1 3.4 41 97.6 17.43 < 0.001 Residual Disease > 2 cm 18 30 42 70 3.38 0.00 15 25 45 75 4.472 < 0.001 < 2 cm 24 85.7 4 14.3 5.4 < 0.001 21 75 7 25 3.055 0.005 CR Complete response, PR Partial response Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 6 of 9 Table 2 P values of statistical analysis of different clinical and free survival time was 11 months, and the median pathological parameters corrected survival time was 21 months. In univariate a b Mann Whitney U test Pearson’sX2 analysis, FIGO stage (P = 0.04), histological type (P = 0.094), differentiation grade (P < 0 .001), ascites Tumor stage > 0.9999 < 0.0001 (P < 0.001), residual disease (P < 0.001) and response Histopathological Grade > 0.9999 < 0.0001 to chemotherapy (P = 0.004) were correlated to cor- Pathological type > 0.9999 < 0.0001 KIP1 rected survival. Expression p27 by immunostain- Ascites > 0.9999 < 0.0001 ing or qRT-PCR did not reach statistical significance Response to treatment > 0.9999 < 0.0001 when its effect on survival was examined. Meanwhile, Residual disease 0.6667 < 0.0001 in multivariate analysis, residual disease, histological Mann Whitney U test between Positive p27 by IHC and increased expression type, differentiation, ascites was of independent prog- b 2 by RT-PCR and different parameters, Pearson’sX test between positive and nostic significance (Table 4). negative P27 by IHC and by RT-PCR and different parameters Table 3 Comparison of P27kip1 assessment by immunohistochemistry, qRT-PCR, and different prognostic parameters No. RNA IHC X P Stage No % No % a b IIIA 10 Upreg or positive IHC 8 80 8 80 0.313 0.576 Downreg. or negative IHC 2 20 2 20 IIIB 12 Upreg or positive IHC 10 83.3 10 83.3 0.3 0.584 Downreg. or negative IHC 2 16.7 2 16.7 IIIC 66 Upreg or positive IHC 42 63.6 42 63.6 0.033 0.856 Downreg. or negative IHC 24 36.4 24 36.4 Grade Mod. + Well 30 Upreg or positive IHC 26 86.7 26 86.7 0.144 0.704 Downreg. or negative IHC 4 13.3 4 13.3 Poor 58 Upreg or positive IHC 16 27.6 16 27.6 0.043 0.835 Downreg. or negative IHC 42 72.4 42 72.4 Pathology serous 64 Upreg or positive IHC 43 67.2 38 59.4 0.538 0.463 Downreg. or negative IHC 21 32.8 26 40.6 NS 24 Upreg or positive IHC 2 8.3 4 16.7 0.19 0.663 Downreg. or negative IHC 22 91.7 20 83.3 Ascites present 60 Upreg or positive IHC 14 23.3 18 30 0.384 0.536 Downreg. or negative IHC 46 76.7 42 70 absent 28 Upreg or positive IHC 24 85.7 24 85.7 0.146 0.703 Downreg. or negative IHC 4 14.3 4 14.3 Resid Dis > 2 cm 60 Upreg or positive IHC 15 25 18 30 0.167 0.683 Downreg. or negative IHC 45 75 42 70 < 2 cm 28 Upreg or positive IHC 21 75 24 85.7 0.453 0.501 Downreg. or negative IHC 7 25 4 14.3 Response CR, Micro dis., PR 46 Upreg or positive IHC 41 89.1 40 87 0 >.999 Downreg. or negative IHC 5 10.9 6 13 NR or progressive dis. 42 Upreg or positive IHC 1 2.4 2 4.8 0 >.999 Downreg. or negative IHC 41 97.6 40 95.2 a b c d e f g Upregulation; Immunohistochemistry; downregulation; Moderate and well-differentiated; non-serous; residual disease; CR complete response, Micro dis.: microscopic disease, PR: partial response and NR no response, progressive dis.: progressive disease Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 7 of 9 Table 4 Multivariate analysis of prognostic factors, using corrected survival as an endpoint Variable Grouping P Ratio of risk 95% CI Response CR, Micro dis., PR vs NR or progressive dis. 0.013 1.05 0.45–1.42 Residual disease < 2 cm vs > 2 cm 0.0012 1.95 1.29–2.92 Grade Well vs. moderate/poor 0.0034 2.69 1.34–5.37 Pathology Serous vs. non-serous 0.043 1.42 0.99–2.04 Ascites Present vs. absent 0.048 1.47 1.01–2.16 Discussion the treatment of ovarian cancer. In our study, a signifi- kip1 KIP1 In this study, the prognostic role of p27 expression cant correlation was found between the level of p27 was evaluated in 88 patients with locally advanced ovar- expression and response to chemotherapy, as its de- kip1 ian cancer. P27 was regarded as a tumor suppressor creased expression was linked to no or poor response to gene and the loss of its function was associated with the chemotherapy. Mudan Lu et al. [31] in their meta- KIP1 development of many kinds of human cancer. The analysis also observed that p27 -positive cases have a kip1 tumor suppressor function of p27 was first involved higher response to chemotherapy, especially in patients in the regulation of the cell cycle [20]. Several trials have who were optimally cytoreduced at first surgery. KIP1 shown that expression of the CDK inhibitor p27 is a Platinum-based chemotherapy induces apoptosis in good predictor of longer time to progression and overall tumor cells, and reduced susceptibility to apoptosis has survival in many ovarian cancer patients [21–24]. Other been proposed as a major mechanism responsible for KIP1 studies evaluating the prognostic function of p27 ex- chemotherapy resistance [33]. Recent data also suggest KIP1 pression in various types of tumors. In specific, loss of that p27 overexpression induces apoptosis in many p27 KIP1 expression markedly improves the risk of re- types of cancers through a p53-independent pathway currence and death related cancer in breast [25], pros- [34–37]. Additionally, in many human breast cancer KIP1 tate [26], bladder [27], hepatocellular [28], and colorectal specimens, p27 levels showed a significant correl- [29] carcinomas. Although p27 expression appears to be ation with the apoptotic index and predictive value for an important predictor of clinical behavior in several the benefit of chemotherapy [34]. KIP1 malignancies, current evidence suggests that loss of P27 expression may confer possible p53-independent Kip1 p27 protein is not attributable to structural alter- apoptosis sensitivity, thus increasing the sensitivity of ovar- ations of the gene [20] but may result from increased ian cancer cells to chemotherapy agents. degradation of the protein-mediated by ubiquitin- proteasome pathway [29, 30]. Conclusion KIP1 In the present study, correlations were observed with This study provides evidence about the role of p27 favorable prognostic factors such as lower FIGO stage, in ovarian cancer patients as a predictor for patient out- differentiated tumors, absence of ascites and residual comes. Patients with ovarian cancer who have a loss of KIP1 KIP1 disease < 2 cm and response to chemotherapy. p27 p27 expression are at a greater likelihood of disease was shown not to be of prognostic significance in ad- progression and may eventually benefit from more ag- KIP1 vanced ovarian cancer by both immunostainings and gressive therapy. The reliability of p27 as a possible measurement of mRNA by real-time PCR. This is com- marker in the clinical routine evaluation and manage- parable with the results of Mudan Lu et al., that discov- ment of ovarian cancer merits further analysis in a study KIP1 ered that p27 expression by immunohistochemistry involving a large number of patients. Finally, this study had independent prognostic significance in the meta- provides evidence of equal reliability of immunohisto- analysis, including nine trials: six conducted in Europe, chemistry and qRT-PCR in the determination of p27 KIP1 three conducted in the USA, and one study conducted in Asia [31]. Hafez et al. [32] also discovered the same Acknowledgements outcomes, by evaluating the concentrations of gene ex- Not applicable. pression using real-time PCR and Western blotting. We also examined the possible predictive value of p27 Authors’ contributions KIP1 Amani A Alrehaili performed the research and analyzed the data. M in the prediction of response to chemotherapy, as AlMourgi: performed the research and analyzed the data. Amal F Gharib: there is increasing evidence that p27 KIP1 functions as a designed the research study; performed the research; analyzed the data and regulator of drug resistance in solid tumors [30]. In hu- wrote the paper. W H Elsawy: designed the research study; performed the KIP1 research; analyzed the data and wrote the paper. Khadiga Ahmed Ismail: man colon cancer cells, overexpression of p27 was performed the research and analyzed the data. Howaida Mahmoud Hagag: linked to increased resistance to drugs like cisplatin, performed the research, analyzed the data and contributed essential doxorubicin, and etoposide [30], these drugs also used in reagents. Farah Anjum: analyzed the data. Nermin Raafat: performed the Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 8 of 9 research, analyzed the data and contributed essential reagents. The authors mechanisms of cell cycle control. J Proteomics. 2017;151:2–11. https://doi. read and approved the final manuscript. org/10.1016/j.jprot.2016.06.009. 9. Bakr MM, Guan S, Firth N, Love RM. Cyclin D1 and P27KIP1: the gatekeepers of dysplasia. J Immunological Sci. 2018;2(3):30–9. Funding 10. Gao Y, Shen J, Choy E, Mankin H, Hornicek F, Duan Z. Inhibition of CDK4 This research did not receive any specific grant from funding agencies in the sensitizes multidrug resistant ovarian cancer cells to paclitaxel by increasing public, commercial, or not-for-profit sectors. apoptosiss. Cell Oncol. 2017;40(3):209–18. https://doi.org/10.1007/s13402- 017-0316-x. Availability of data and materials 11. Lu M, Wang Y, Xu F, Xiang J, Chen D. The prognostic of p27 kip1 in The datasets used and/or analyzed during the current study are available ovarian cancer: a meta-analysis. Arch Gynecol Obstet. 2016;293(1):169–76. from the corresponding author on request. https://doi.org/10.1007/s00404-015-3817-8. 12. Lu M, Wang Y, Xu F, Xiang J, Chen D. The prognostic of p27 kip1 in Ethics approval and consent to participate ovarian cancer: a meta-analysis. Arch Gynecol Obstet. 2016;293(1):169–76. The study was approved by the Committee of Ethics of research, Zagazig https://doi.org/10.12892/ejgo3784.2018. University. Informed consent was obtained from all participating patients 13. Al-Maghrabi J, Emam E, Gomaa W, Saggaf M, Buhmeida A, Al-Qahtani M, before enrollment in the study. et al. C-MET immunostaining in colorectal carcinoma is associated with local disease recurrence. BMC Cancer. 2015;15(1):676. https://doi.org/10. Consent for publication 1186/s12885-015-1662-6. All authors consent to the publication of the manuscript in ACR, should the 14. Prat J. FIGO committee on gynecologic oncology. FIGO's staging article be accepted by the Editor-in-chief upon completion of the refereeing classification for cancer of the ovary, fallopian tube, and peritoneum: process. abridged republication. J Gynecol Oncol. 2015;26(2):87–9. https://doi.org/10. 3802/jgo.2015.26.2.87. 15. Prigerson HG, Bao Y, Shah MA, Paulk ME, LeBlanc TW, Schneider BJ, et al. Competing interests Chemotherapy use, performance status, and quality of life at the end of life. The authors declare that they have no competing interests. JAMA Oncol. 2015;1(6):778–84. https://doi.org/10.1001/jamaoncol.2015.2378. 16. Nishino M, Jagannathan JP, Ramaiya NH, Van den Abbeele AD. Revised Author details RECIST guideline version 1.1: what oncologists want to know and what Clinical Laboratory Department, College of Applied Medical Sciences, Taif radiologists need to know. Am J Roentgenol. 2010;195(2):281–9. University, Taif, Saudi Arabia. Department of Surgery, Medical College, Taif University, Taif, Saudi Arabia. Medical Biochemistry and Molecular Biology 17. Guo Y, Sklar GN, Borkowski A, Kyprianou N. Loss of the cyclin-dependent Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt. Clinical kinase inhibitor p27 (Kip1) protein in human prostate cancer correlates with Oncology Department, Faculty of Medicine, Zagazig University, Zagazig, tumor grade. Clin Cancer Res. 1997;3(12):2269–74. Egypt. Medical Parasitology Department, Faculty of Medicine, Ain-Shams 18. Masciullo V, Sgambato A, Pacilio C, Pucci B, Ferrandina G, Palazzo J, et al. University, Cairo, Egypt. Pathology Department, Al Azhar University Egypt, Frequent loss of expression of the cyclin-dependent kinase inhibitor p27 in Cairo, Egypt. epithelial ovarian cancer. Cancer Res. 1999;59(15):3790–4. 19. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C Received: 28 August 2019 Accepted: 25 May 2020 T method. Nat Protoc. 2008;3(6):1101. 20. Kalra S, Joshi G, Munshi A, Kumar R. Structural insights of cyclin dependent kinases: implications in design of selective inhibitors. Eur J Med Chem. 2017; 142:424–58. https://doi.org/10.1016/j.ejmech.2017.08.071. References 21. Masciullo V, Ferrandina G, Pucci B, Fanfani F, Lovergine S, Palazzo J, et al. 1. Torre LA, Trabert B, DeSantis CE, Miller KD, Samimi G, Runowicz CD, et al. p27Kip1 expression is associated with clinical outcome in advanced Ovarian cancer statistics, 2018. CA Cancer J Clin. 2018;68(4):284–96. epithelial ovarian cancer: multivariate analysis. Clin Cancer Res. 2000;6(12): 2. Jaaback K, Johnson N, Lawrie TA. Intraperitoneal chemotherapy for the 4816–22. initial management of primary epithelial ovarian cancer. Cochrane Database 22. Hashimoto T, Yanaihara N, Okamoto A, Nikaido T, Saito M, Takakura S, et al. Syst Rev. 2016;1:CD005340. Cyclin D1 predicts the prognosis of advanced serous ovarian cancer. Exp 3. Oza AM, Cook AD, Pfisterer J, Embleton A, Ledermann JA, Pujade-Lauraine E, Ther Med. 2011;2(2):213–9. https://doi.org/10.3892/etm.2011.194. et al. Standard chemotherapy with or without bevacizumab for women 23. Psyrri A, Bamias A, Yu Z, Weinberger PM, Kassar M, Markakis S, et al. with newly diagnosed ovarian cancer (ICON7): overall survival results of a Subcellular localization and protein levels of cyclin-dependent kinase phase 3 randomised trial. Lancet Oncol. 2015;16(8):928–36. https://doi.org/ inhibitor p27 independently predict for survival in epithelial ovarian cancer. 10.1016/S1470-2045(15)00086-8. Clin Cancer Res. 2005;11(23):8384–90. 4. Kartal-Yandim M, Aysun AG, Yusuf B. Molecular mechanisms of drug 24. Bali A, O’Brien PM, Edwards LS, Sutherland RL, Hacker NF, Henshall SM. resistance and its reversal in cancer. Crit Rev Biotechnol. 2015;36(4):716–26. Cyclin D1, p53, and p21Waf1/Cip1 expression is predictive of poor clinical https://doi.org/10.3109/07388551.1015957. outcome in serous epithelial ovarian cancer. Clin Cancer Res. 2004;10(15): 5. Dahm-Kähler P, Borgfeldt C, Holmberg E, Staf C, Falconer H, Bjurberg M, 5168–77. et al. Population-based study of survival for women with serous cancer of 25. Kalra S, Joshi G, Munshi A, Kumar R. Structural insights of cyclin dependent the ovary, fallopian tube, peritoneum or undesignated origin-on behalf of kinases: implications in design of selective inhibitors. Eur J Med Chem. 2017; the Swedish gynecological cancer group (SweGCG). Gynecol Oncol. 2017; 142:424–58. 144(1):167–73. https://doi.org/10.1016/j.ygyno.2016.10.039. 26. Cusan M, Mungo G, De Marco ZM, Segatto I, Belletti B, Baldassarre G. 6. Thwaites MJ, Cecchini MJ, Passos DT, Welch I, Dick FA. Interchangeable roles Landscape of CDKN1B mutations in luminal breast cancer and other for E2F transcriptional repression by the retinoblastoma protein and hormone-driven human tumors. Front Endocrinol. 2018;9:393. https://doi. p27KIP1–cyclin-dependent kinase regulation in cell cycle control and tumor org/10.3389/fendo.2018.00393. suppression. Mol Cell Biol. 2017;37(2):e00561–16. https://doi.org/10.1128/ 27. Ronen S, Abbott DW, Kravtsov O, Abdelkader A, Xu Y, Banerjee A, et al. MCB.00561-16. PTEN loss and p27 loss differ among morphologic patterns of prostate 7. Mazumdar A, Hill J, Zhang Y, Bollu LR, Tsimelzon A, Chang J, Mills G, Brown cancer, including cribriform. Hum Pathol. 2017;65:85–91. https://doi.org/10. P. Induced expression of PPM1A in ER-negative breast cancer cells inhibits 1016/j.humpath.2017.04.024. growth by suppressing CDK phosphorylation. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 28. Hu B, Hua L, Ni W, Wu M, Yan D, Chen Y, et al. Nucleostemin/GNL3 1–5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017; 77(13 promotes nucleolar polyubiquitylation of p27kip1 to drive hepatocellular Suppl):Abstract nr 5525. doi:https://doi.org/10.1158/1538-7445.AM2017-5525. carcinoma progression. Cancer Lett. 2017;338:220–9. https://doi.org/10.1016/ 8. Grassi ML, de Souza PC, Thomé CH, Lanfredi GP, Poersch A, Faça VM. j.canlet.2016.12.008. Proteomic analysis of ovarian cancer cells during epithelial-mesenchymal 29. Li W, Zhang G, Wang HL, Wang L. Analysis of expression of cyclin E, p27kip1 transition (EMT) induced by epidermal growth factor (EGF) reveals and Ki67 protein in colorectal cancer tissues and its value for diagnosis, Alrehaili et al. Applied Cancer Research (2020) 40:6 Page 9 of 9 treatment and prognosis of disease. Eur Rev Med Pharmacol Sci. 2016; 20(23):4874–9. 30. Randles L, Anchoori RK, Roden RB, Walters KJ. The proteasome ubiquitin receptor hRpn13 and its interacting deubiquitinating enzyme Uch37 are required for proper cell cycle progression. J Biol Chem. 2016;291(16):8773– 83. https://doi.org/10.1074/jbc. M115.694588. 31. Lu M, Wang Y, Xu F, Xiang J, Chen D. The prognostic of p27kip1 in ovarian cancer: a meta-analysis. Arch Gynecol Obstet. 2016;293:169. https://doi.org/ 10.1007/s00404-015-3817-8. 32. Hafez MM, Alhoshani AR, Al-Hosaini KA, Alsharari SD, Al Rejaie SS, Sayed- Ahmed MM, et al. SKP2/P27Kip1 pathway is associated with advanced ovarian cancer in Saudi patients. Asian Pac J Cancer Prev. 2015;16(14):5807–15. 33. Asghar U, Witkiewicz AK, Turner NC, Knudsen ES. The history and future of targeting cyclin-dependent kinases in cancer therapy. Nat Rev Drug Discov. 2015;14:130–46. https://doi.org/10.1038/nrd4504. 34. Otto T, Sicinski P. Cell cycle proteins as promising targets in cancer therapy. Nat Rev Cancer. 2017;17(2):93. 35. Lu K, Wang J, Song Y, Zhao S, Liu H, Tang D, et al. miRNA-24-3p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting p27Kip1. Oncol Rep. 2015;34(2):995–1002. https://doi.org/10.3892/or.2015.4025. 36. Liu H, Liu Y, Bian Z, Zhang J, Zhang R, Chen X, et al. Circular RNA YAP1 inhibits the proliferation and invasion of gastric cancer cells by regulating the miR-367-5p/p27 Kip1 axis. Mol Cancer. 2018;17(1):151. 37. Ramu V, Gill MR, Jarman PJ, Turton D, Thomas JA, Das A, et al. A cytostatic ruthenium (II)–platinum (II) Bis (terpyridyl) anticancer complex that blocks entry into S phase by up-regulating p27KIP1. Chem A Eur J. 2015;21:9185–97. https://doi.org/10.1002/chem.201500561. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Applied Cancer Research – Springer Journals
Published: Jun 3, 2020
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.